BD2 (DEFB4A) (NM_004942) Human Untagged Clone

CAT#: SC303551

DEFB4A (untagged)-Human defensin, beta 4A (DEFB4A)


  "NM_004942" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "DEFB4A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DEFB4A
Synonyms BD-2; DEFB-2; DEFB2; DEFB4; DEFB102; HBD-2; SAP1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_004942 edited
TGGTGAAGCTCCCAGCCATCAGCCATGAGGGTCTTGTATCTCCTCTTCTCGTTCCTCTTC
ATATTCCTGATGCCTCTTCCAGGTGTTTTTGGTGGTATAGGCGATCCTGTTACCTGCCTT
AAGAGTGGAGCCATATGTCATCCAGTCTTTTGCCCTAGAAGGTATAAACAAATTGGCACC
TGTGGTCTCCCTGGAACAAAATGCTGCAAAAAGCCATGAGGAGGCCAAGAAGCTGCTGTG
GCTGATGCGGATT
Restriction Sites Please inquire     
ACCN NM_004942
Insert Size 250 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_004942.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004942.2, NP_004933.1
RefSeq Size 336 bp
RefSeq ORF 195 bp
Locus ID 1673
Cytogenetics 8p23.1
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Gene Summary 'Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 4, an antibiotic peptide which is locally regulated by inflammation. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.