PRB1 (NM_005039) Human Untagged Clone

CAT#: SC303564

PRB1 (untagged)-Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRB1
• Synonyms: PM; PMF; PMS; PRB1L; PRB1M
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005039, the custom clone sequence may differ by one or more nucleotides
  ATGCTGTTGATTCTGCTGTCAGTGGCCTTGCTGGCCCTGAGCTCAGCTCAGAACTTAAAT
  GAAGATGTCAGCCAGGAAGAATCTCCCTCCCTAATAGCAGGAAATCCACAAGGACCATCC
  CCACAAGGAGGCAACAAGCCCCAGGGCCCCCCACCTCCTCCAGGAAAGCCACAAGGACCA
  CCCCCACAAGGAGGCAACAAACCTCAAGGTCCCCCACCTCCAGGAAAGCCACAAGGACCA
  CCCCCACAAGGGGACAAGTCCCGAAGTCCCCGATCTCCTCCAGGAAAACCACAAGGACCA
  CCCCCACAAGGAGGTAACCAGCCCCAAGGTCCCCCACCTCCTCCAGGAAAGCCACAAGGA
  CCACCCCCACAAGGAGGCAACAGACCTCAAGGTCCCCCACCTCCAGGAAAGCCACAAGGA
  CCACCCCCACAAGGAGACAAGTCCCGAAGTCCCCGATCTCCTCCAGGAAAGCCACAAGGA
  CCACCCCCACAAGGAGGTAACCAACCCCAAGGTCCCCCACCTCCTCCAGGAAAGCCACAA
  GGACCACCCCCACAAGGAGGCAAGAAACCTCAGGGTCCCCCACCTCCAGGAAAGCCACAA
  GGACCACCCCCACAAGGAGACAAGTCCCGAAGTTCCCAATCTCCTCCAGGAAAGCCACAA
  GGACCACCCCCACAAGGAGGCAACCAGCCCCAAGGTCCCCCACCTCCTCCAGGAAAGCCA
  CAAGGACCACCCCCACAAGGAGGCAACAAACCTCAAGGTCCCCCACCTCCAGGAAAGCCA
  CAAGGACCACCCGCACAAGGAGGCAGCAAGTCCCAAAGTGCCCGATCTCCTCCAGGAAAG
  CCACAAGGACCACCCCAACAAGAAGGCAACAATCCTCAAGGTCCCCCACCTCCAGCAGGA
  GGCAATCCCCAGCAGCCTCAGGCACCTCCTGCTGGACAGCCCCAGGGACCACCACGCCCT
  CCTCAAGGGGGCAGACCTTCCAGACCTCCCCAGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_005039
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005039.2, NP_005030.2
• RefSeq Size: 1173 bp
• RefSeq ORF: 996 bp
• Locus ID: 5542
• Cytogenetics: 12p13.2
• Protein Families: Druggable Genome
• Gene Summary: 'This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats have been identified. The reference genome encodes the "Medium" allele. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because transcript sequence consistent with the reference genome assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments.