FGF3 (NM_005247) Human Untagged Clone
CAT#: SC303609
FGF3 (untagged)-Human fibroblast growth factor 3 (FGF3)
"NM_005247" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FGF3 |
Synonyms | HBGF-3; INT2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_005247, the custom clone sequence may differ by one or more nucleotides
ATGGGCCTAATCTGGCTGCTACTGCTCAGCCTGCTGGAGCCCGGCTGGCCCGCAGCGGGCCCTGGGGCGC GGTTGCGGCGCGATGCGGGCGGCCGTGGCGGCGTCTACGAGCACCTTGGCGGGGCGCCCCGGCGCCGCAA GCTCTACTGCGCCACGAAGTACCACCTCCAGCTGCACCCGAGCGGCCGCGTCAACGGCAGCCTGGAGAAC AGCGCCTACAGTATTTTGGAGATAACGGCAGTGGAGGTGGGCATTGTGGCCATCAGGGGTCTCTTCTCCG GGCGGTACCTGGCCATGAACAAGAGGGGACGACTCTATGCTTCGGAGCACTACAGCGCCGAGTGCGAGTT TGTGGAGCGGATCCACGAGCTGGGCTATAATACGTATGCCTCCCGGCTGTACCGGACGGTGTCTAGTACG CCTGGGGCCCGCCGGCAGCCCAGCGCCGAGAGACTGTGGTACGTGTCTGTGAACGGCAAGGGCCGGCCCC GCAGGGGCTTCAAGACCCGCCGCACACAGAAGTCCTCCCTGTTCCTGCCCCGCGTGCTGGACCACAGGGA CCACGAGATGGTGCGGCAGCTACAGAGTGGGCTGCCCAGACCCCCTGGTAAGGGGGTCCAGCCCCGACGG CGGCGGCAGAAGCAGAGCCCGGATAACCTGGAGCCCTCTCACGTTCAGGCTTCGAGACTGGGCTCCCAGC TGGAGGCCAGTGCGCACTAG |
Restriction Sites | Please inquire |
ACCN | NM_005247 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005247.2, NP_005238.1 |
RefSeq Size | 1548 bp |
RefSeq ORF | 720 bp |
Locus ID | 2248 |
Cytogenetics | 11q13.3 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
Gene Summary | 'The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its similarity with mouse fgf3/int-2, a proto-oncogene activated in virally induced mammary tumors in the mouse. Frequent amplification of this gene has been found in human tumors, which may be important for neoplastic transformation and tumor progression. Studies of the similar genes in mouse and chicken suggested the role in inner ear formation. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220125 | FGF3 (Myc-DDK-tagged)-Human fibroblast growth factor 3 (FGF3) |
USD 420.00 |
|
RG220125 | FGF3 (GFP-tagged) - Human fibroblast growth factor 3 (FGF3) |
USD 460.00 |
|
RC220125L1 | Lenti ORF clone of Human fibroblast growth factor 3 (FGF3), Myc-DDK-tagged |
USD 768.00 |
|
RC220125L2 | Lenti ORF clone of Human fibroblast growth factor 3 (FGF3), mGFP tagged |
USD 620.00 |
|
RC220125L3 | Lenti ORF clone of Human fibroblast growth factor 3 (FGF3), Myc-DDK-tagged |
USD 620.00 |
|
RC220125L4 | Lenti ORF clone of Human fibroblast growth factor 3 (FGF3), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review