TNP2 (NM_005425) Human Untagged Clone

CAT#: SC303643

TNP2 (untagged)-Human transition protein 2 (during histone to protamine replacement) (TNP2)


  "NM_005425" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TNP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TNP2
Synonyms TP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_005425, the custom clone sequence may differ by one or more nucleotides


ATGGACACCCAGACTCACAGCCTTCCTATCACCCACACTCAGCTCCATAGCAACTCTCAGCCCCAAAGCC
GCACCTGCACCCGCCATTGCCAAACCTTCAGCCAGAGTTGCAGACAGAGCCATCGTGGCAGCCGGAGCCA
GAGCTCCAGCCAGAGCCCGGCCAGCCACCGCAACCCAACTGGAGCCCACAGCTCATCCGGCCACCAGAGC
CAGAGTCCCAACACTAGTCCACCACCAAAGCGCCACAAAAAGACTATGAACTCCCACCACTCTCCCATGC
GGCCCACCATCCTGCACTGCCGCTGCCCCAAGAACAGAAAGAACTTGGAAGGCAAGCTGAAAAAGAAAAA
AATGGCCAAGAGGATCCAGCAGGTGTACAAAACCAAGACGCGGAGCTCAGGATGGAAATCCAACTAA


Restriction Sites SgfI-MluI     
ACCN NM_005425
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005425.4, NP_005416.1
RefSeq Size 599 bp
RefSeq ORF 417 bp
Locus ID 7142
Cytogenetics 16p13.13
Gene Summary ''

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.