SOX1 (NM_005986) Human Untagged Clone

CAT#: SC303713

SOX1 (untagged)-Human SRY (sex determining region Y)-box 1 (SOX1)


  "NM_005986" in other vectors (6)

Reconstitution Protocol

USD 670.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SOX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SOX1
Synonyms SRY (sex determining region Y)-box 1; SRY-related HMG-box gene 1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005986 edited
ATGTACAGCATGATGATGGAGACCGACCTGCACTCGCCCGGCGGCGCCCAGGCCCCCACG
AACCTCTCGGGCCCCGCCGGGGCGGGCGGCGGCGGGGGCGGAGGCGGGGGCGGCGGCGGC
GGCGGGGGCGCCAAGGCCAACCAGGACCGGGTCAAACGGCCCATGAACGCCTTCATGGTG
TGGTCCCGCGGGCAGCGGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAG
ATCAGCAAGCGCCTGGGGGCCGAGTGGAAGGTCATGTCCGAGGCCGAGAAGCGGCCGTTC
ATCGACGAGGCCAAGCGGCTGCGCGCGCTGCACATGAAGGAGCACCCGGATTACAAGTAC
CGGCCGCGCCGCAAGACCAAGACGCTGCTCAAGAAGGACAAGTACTCGCTGGCCGGCGGG
CTCCTGGCGGCCGGCGCGGGTGGCGGCGGCGCGGCTGTGGCCATGGGCGTGGGCGTGGGC
GTGGGCGCGGCGGCCGTGGGCCAGCGCCTGGAGAGCCCAGGCGGCGCGGCGGGCGGCGGC
TACGCGCACGTCAACGGCTGGGCCAACGGCGCCTACCCCGGCTCGGTGGCGGCGGCGGCG
GCGGCCGCGGCCATGATGCAGGAGGCGCAGCTGGCCTACGGGCAGCACCCGGGCGCGGGC
GGCGCGCACCCGCACGCGCACCCCGCGCACCCGCACCCGCACCACCCGCACGCGCACCCG
CACAACCCGCAGCCCATGCACCGCTACGACATGGGCGCGCTGCAGTACAGCCCCATCTCC
AACTCGCAGGGCTACATGAGCGCGTCGCCCTCGGGCTACGGCGGCCTCCCCTACGGCGCC
GCGGCCGCCGCCGCCGCCGCTGCGGGCGGCGCGCACCAGAACTCGGCCGTGGCGGCGGCG
GCGGCGGCGGCGGCCGCGTCGTCGGGCGCCCTGGGCGCGCTGGGCTCTCTGGTGAAGTCG
GAGCCCAGCGGCAGCCCGCCCGCCCCAGCGCACTCGCGGGCGCCGTGCCCCGGGGACCTG
CGCGAGATGATCAGCATGTACTTGCCCGCCGGCGAGGGGGGCGACCCGGCGGCGGCAGCA
GCGGCCGCGGCGCAGAGCCGGCTGCACTCGCTGCCGCAGCACTACCAGGGCGCGGGCGCG
GGCGTGAACGGCACGGTGCCCCTGACGCACATCTAG
Restriction Sites Please inquire     
ACCN NM_005986
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005986.2, NP_005977.2
RefSeq Size 4108 bp
RefSeq ORF 1176 bp
Locus ID 6656
Cytogenetics 13q34
Protein Families Adult stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transmembrane
Gene Summary 'This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. In mice, a similar protein regulates the gamma-crystallin genes and is essential for lens development. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.