PDE6H (NM_006205) Human Untagged Clone

CAT#: SC303750

PDE6H (untagged)-Human phosphodiesterase 6H, cGMP-specific, cone, gamma (PDE6H)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PDE6H
• Synonyms: ACHM6; RCD3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006205, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTGACAACACTACTCTGCCTGCTCCAGCTTCAAACCAGGGTCCTACCACCCCACGCAAAGGCCCTC
  CCAAGTTCAAGCAGAGGCAGACTCGCCAATTCAAGAGTAAACCTCCAAAGAAAGGTGTGAAAGGATTTGG
  AGATGACATTCCAGGAATGGAGGGGCTAGGAACAGATATCACAGTGATTTGTCCATGGGAGGCATTCAGC
  CACCTGGAATTGCATGAGCTCGCTCAGTTTGGGATTATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006205
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006205.2, NP_006196.1
• RefSeq Size: 763 bp
• RefSeq ORF: 252 bp
• Locus ID: 5149
• Cytogenetics: 12p12.3
• Protein Pathways: Progesterone-mediated oocyte maturation, Purine metabolism
• Gene Summary: 'This gene encodes the inhibitory (or gamma) subunit of the cone-specific cGMP phosphodiesterase, which is a tetramer composed of two catalytic chains (alpha and beta), and two inhibitory chains (gamma). It is specifically expressed in the retina, and is involved in the transmission and amplification of the visual signal. Mutations in this gene are associated with retinal cone dystrophy type 3A (RCD3A). [provided by RefSeq, Mar 2010]'