BRN3A (POU4F1) (NM_006237) Human Untagged Clone

CAT#: SC303757

POU4F1 (untagged)-Human POU class 4 homeobox 1 (POU4F1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: POU4F1
• Synonyms: brn-3A; BRN3A; Oct-T1; RDC-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006237, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGTCCATGAACAGCAAGCAGCCTCACTTTGCCATGCATCCCACCCTCCCTGAGCACAAGTACCCGT
  CGCTGCACTCCAGCTCCGAGGCCATCCGGCGGGCCTGCCTGCCCACGCCGCCGCTGCAGAGCAACCTCTT
  CGCCAGCCTGGACGAGACGCTGCTGGCGCGGGCCGAGGCGCTGGCGGCCGTGGACATCGCCGTGTCCCAG
  GGCAAGAGCCATCCTTTCAAGCCGGACGCCACGTACCACACGATGAACAGCGTGCCGTGCACGTCCACTT
  CCACGGTGCCTCTGGCGCACCACCACCACCACCACCACCACCACCAGGCGCTCGAACCCGGCGATCTGCT
  GGACCACATCTCCTCGCCGTCGCTCGCGCTCATGGCCGGCGCGGGCGGCGCGGGCGCGGCGGCCGGCGGC
  GGCGGCGCCCACGACGGCCCGGGGGGCGGTGGCGGCCCGGGCGGCGGCGGCGGCCCGGGCGGCGGCCCCG
  GGGGAGGCGGCGGTGGCGGCCCGGGGGGCGGCGGCGGCGGCCCGGGCGGCGGGCTCCTGGGCGGCTCCGC
  GCACCCTCACCCGCATATGCACAGCCTGGGCCACCTGTCGCACCCCGCGGCGGCGGCCGCCATGAACATG
  CCGTCCGGGCTGCCGCACCCCGGGCTGGTGGCGGCGGCGGCGCACCACGGCGCGGCAGCGGCAGCGGCGG
  CGGCGGCGGCCGGGCAGGTGGCAGCGGCATCGGCGGCGGCGGCCGTGGTGGGCGCAGCGGGCCTGGCGTC
  CATCTGCGACTCGGACACGGACCCGCGCGAGCTCGAGGCGTTCGCGGAGCGCTTCAAGCAGCGGCGCATC
  AAGCTGGGCGTGACGCAGGCCGACGTGGGCTCGGCGCTGGCCAACCTCAAGATCCCGGGCGTGGGCTCAC
  TCAGCCAGAGCACCATCTGCAGGTTCGAGTCGCTCACGCTCTCGCACAACAACATGATCGCGCTCAAGCC
  CATCCTGCAGGCGTGGCTCGAGGAGGCCGAGGGCGCCCAGCGCGAGAAAATGAACAAGCCTGAGCTCTTC
  AACGGCGGCGAGAAGAAGCGCAAGCGGACTTCCATCGCCGCGCCCGAGAAGCGCTCCCTCGAGGCCTACT
  TCGCCGTGCAGCCCCGGCCCTCGTCCGAGAAGATCGCCGCCATCGCCGAGAAACTGGACCTCAAAAAGAA
  CGTGGTGCGGGTGTGGTTTTGCAACCAGAGACAGAAGCAGAAGCGGATGAAATTCTCTGCCACTTACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006237
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006237.3, NP_006228.3
• RefSeq Size: 3817 bp
• RefSeq ORF: 1260 bp
• Locus ID: 5457
• Cytogenetics: 13q31.1
• Protein Families: Transcription Factors
• Gene Summary: 'This gene encodes a member of the POU-IV class of neural transcription factors. This protein is expressed in a subset of retinal ganglion cells and may be involved in the developing sensory nervous system. This protein may also promote the growth of cervical tumors. A translocation of this gene is associated with some adult acute myeloid leukemias. [provided by RefSeq, Mar 2012]'