PRB3 (NM_006249) Human Untagged Clone
CAT#: SC303759
PRB3 (untagged)-Human proline-rich protein BstNI subfamily 3 (PRB3)
"NM_006249" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PRB3 |
Synonyms | G1; PRG |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_006249, the custom clone sequence may differ by one or more nucleotides
ATGCTACTGATTCTGCTGTCGGTGGCCCTGCTGGCCCTGAGCTCAGCTCAGAGCTTAAAT GAAGATGTCAGCCAGGAAGAATCTCCCTCCGTAATATCAGGAAAGCCAGAAGGACGACGC CCACAAGGAGGAAACCAGCCCCAACGTACCCCACCTCCTCCAGGAAAGCCAGAAGGACGA CCCCCACAAGGAGGCAACCAGTCCCAAGGTCCCCCACCTCGTCCAGGAAAGCCAGAAGGA CCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCACCTCGTCCGGGAAAGCCAGAA GGACAACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCACCTCGTCCGGGAAAGCCA GAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCGCCTCGTCCGGGAAAG CCAGAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCGCCTCGTCCGGGA AAGCCAGAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCGCCTCATCCG GGAAAGCCAGAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCACCTCGT CCGGGAAAGCCAGAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCACCT CGTCCAGGAAAGCCAGAAGGACCACCTTCACAAGGAGGCAACAAACCTCAAGGTCCCCCA CCTCATCCAGGAAAGCCACAAGGACCACCCCCACAAGAAGGTAACAAACCTCAACGTCCC CCTCCTCCAGGAAGGCCACAAGGACCACCCCCACCAGGAGGCAATCCCCAGCAGCCTCTG CCACCTCCCGCTGGAAAGCCCCAGGGACCACCTCCACCTCCTCAAGGGGGCAGACCACAC AGACCTCCCCAGGGACAGCCTCCCCAGTAA |
Restriction Sites | Please inquire |
ACCN | NM_006249 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006249.3, NP_006240.3 |
RefSeq Size | 1235 bp |
RefSeq ORF | 1101 bp |
Locus ID | 5544 |
Cytogenetics | 12p13.2 |
Protein Families | Druggable Genome |
Gene Summary | 'This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats have been identified. The reference genome encodes the "Long" allele. The protein isoforms encoded by this gene are recognized as the "first line of oral defense" against the detrimental effects of polyphenols in the diet and pathogen infections. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. [provided by RefSeq, Nov 2015]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213438 | PRB3 (Myc-DDK-tagged)-Human proline-rich protein BstNI subfamily 3 (PRB3). Note: ORF is codon optimized |
USD 420.00 |
|
RG213438 | PRB3 (GFP-tagged) - Human proline-rich protein BstNI subfamily 3 (PRB3). Note: ORF is codon optimized |
USD 460.00 |
|
RC213438L3 | Lenti-ORF clone of PRB3 (Myc-DDK-tagged)-Human proline-rich protein BstNI subfamily 3 (PRB3). Note: ORF is codon optimized |
USD 620.00 |
|
RC213438L4 | Lenti-ORF clone of PRB3 (mGFP-tagged)-Human proline-rich protein BstNI subfamily 3 (PRB3). Note: ORF is codon optimized |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review