Lipophilin B (SCGB1D2) (NM_006551) Human Untagged Clone

CAT#: SC303787

SCGB1D2 (untagged)-Human secretoglobin, family 1D, member 2 (SCGB1D2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SCGB1D2
• Synonyms: LIPB; LPHB; LPNB
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006551, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCTGTCGGTGTGTCTCCTGCTGGTCACGCTGGCCCTCTGCTGCTACCAGGCCAATGCCGAGTTCT
  GCCCAGCTCTTGTTTCTGAGCTGTTAGACTTCTTCTTCATTAGTGAACCTCTGTTCAAGTTAAGTCTTGC
  CAAATTTGATGCCCCTCCGGAAGCTGTTGCAGCCAAGTTAGGAGTGAAGAGATGCACGGATCAGATGTCC
  CTTCAGAAACGAAGCCTCATTGCGGAAGTCCTGGTGAAAATATTGAAGAAATGTAGTGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006551
• ORF Size: 273 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_006551.3, NP_006542.1
• RefSeq Size: 454
• RefSeq ORF: 273
• Locus ID: 10647
• Protein Families: Secreted Protein
• Gene Summary: The protein encoded by this gene is a member of the lipophilin subfamily, part of the uteroglobin superfamily, and is an ortholog of prostatein, the major secretory glycoprotein of the rat ventral prostate gland. Lipophilin gene products are widely expressed in normal tissues, especially in endocrine-responsive organs. Assuming that human lipophilins are the functional counterparts of prostatein, they may be transcriptionally regulated by steroid hormones, with the ability to bind androgens, other steroids and possibly bind and concentrate estramustine, a chemotherapeutic agent widely used for prostate cancer. Although the gene has been reported to be on chromosome 10, this sequence appears to be from a cluster of genes on chromosome 11 that includes mammaglobin 2. [provided by RefSeq, Jul 2008]