CD226 (NM_006566) Human Untagged Clone

CAT#: SC303792

CD226 (untagged)-Human CD226 molecule (CD226)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD226
• Synonyms: DNAM-1; DNAM1; PTA1; TLiSA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006566, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATTATCCTACTTTACTTTTGGCTCTTCTTCATGTATACAGAGCTCTATGTGAAGAGGTGCTTTGGC
  ATACATCAGTTCCCTTTGCCGAGAACATGTCTCTAGAATGTGTGTATCCATCAATGGGCATCTTAACACA
  GGTGGAGTGGTTCAAGATCGGGACCCAGCAGGATTCCATAGCCATTTTCAGCCCTACTCATGGCATGGTC
  ATAAGGAAGCCCTATGCTGAGAGGGTTTACTTTTTGAATTCAACGATGGCTTCCAATAACATGACTCTTT
  TCTTTCGGAATGCCTCTGAAGATGATGTTGGCTACTATTCCTGCTCTCTTTACACTTACCCACAGGGAAC
  TTGGCAGAAGGTGATACAGGTGGTTCAGTCAGATAGTTTTGAGGCAGCTGTGCCATCAAATAGCCACATT
  GTTTCGGAACCTGGAAAGAATGTCACACTCACTTGTCAGCCTCAGATGACGTGGCCTGTGCAGGCAGTGA
  GGTGGGAAAAGATCCAGCCCCGTCAGATCGACCTCTTAACTTACTGCAACTTGGTCCATGGCAGAAATTT
  CACCTCCAAGTTCCCAAGACAAATAGTGAGCAACTGCAGCCACGGAAGGTGGAGCGTCATCGTCATCCCC
  GATGTCACAGTCTCAGACTCGGGGCTTTACCGCTGCTACTTGCAGGCCAGCGCAGGAGAAAACGAAACCT
  TCGTGATGAGATTGACTGTAGCCGAGGGTAAAACCGATAACCAATATACCCTCTTTGTGGCTGGAGGGAC
  AGTTTTATTGTTGTTGTTTGTTATCTCAATTACCACCATCATTGTCATTTTCCTTAACAGAAGGAGAAGG
  AGAGAGAGAAGAGATCTATTTACAGAGTCCTGGGATACACAGAAGGCACCCAATAACTATAGAAGTCCCA
  TCTCTACCAGTCAACCTACCAATCAATCCATGGATGATACAAGAGAGGATATTTATGTCAACTATCCAAC
  CTTCTCTCGCAGACCAAAGACTAGAGTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006566
• ORF Size: 1011 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_006566.3, NP_006557.2
• RefSeq Size: 2844
• RefSeq ORF: 1011
• Locus ID: 10666
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs)
• Gene Summary: This gene encodes a glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. The protein mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 encode the same isoform.