CCL27 (NM_006664) Human Untagged Clone

CAT#: SC303807

CCL27 (untagged)-Human chemokine (C-C motif) ligand 27 (CCL27)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCL27
• Synonyms: ALP; CTACK; CTAK; ESKINE; ILC; PESKY; SCYA27
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006664, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGGGCCCCCAACCTTCTGCAGCCTCCTGCTGCTGTCATTGCTCCTGAGCCCAGACCCTACAGCAG
  CATTCCTACTGCCACCCAGCACTGCCTGCTGTACTCAGCTCTACCGAAAGCCACTCTCAGACAAGCTACT
  GAGGAAGGTCATCCAGGTGGAACTGCAGGAGGCTGACGGGGACTGTCACCTCCAGGCTTTCGTGCTTCAC
  CTGGCTCAACGCAGCATCTGCATCCACCCCCAGAACCCCAGCCTGTCACAGTGGTTTGAGCACCAAGAGA
  GAAAGCTCCATGGGACTCTGCCCAAGCTGAATTTTGGGATGCTAAGGAAAATGGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006664
• ORF Size: 339 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_006664.3, NP_006655.1
• RefSeq Size: 475
• RefSeq ORF: 339
• Locus ID: 10850
• Protein Families: Druggable Genome
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• Gene Summary: This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene is chemotactic for skin-associated memory T lymphocytes. This cytokine may also play a role in mediating homing of lymphocytes to cutaneous sites. It specifically binds to chemokine receptor 10 (CCR10). Studies of a similar murine protein indicate that these protein-receptor interactions have a pivotal role in T cell-mediated skin inflammation. [provided by RefSeq, Sep 2014]