Urotensin II (UTS2) (NM_006786) Human Untagged Clone

CAT#: SC303827

UTS2 (untagged)-Human urotensin 2 (UTS2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UTS2
• Synonyms: PRO1068; U-II; UCN2; UII
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_006786 edited
  ATGTATAAGCTGGCCTCCTGCTGTTTGCTTTTCATAGGATTCTTAAATCCTCTCTTATCT
  CTTCCTCTCCTTGACTCCAGGGAAATATCCTTTCAACTCTCAGCACCTCATGAAGACGCG
  CGCTTAACTCCGGAGGAGCTAGAAAGAGCTTCCCTTCTACAGATACTGCCAGAGATGCTG
  GGTGCAGAAAGAGGGGATATTCTCAGGAAAGCAGACTCAAGTACCAACATTTTTAACCCA
  AGAGGAAATTTGAGAAAGTTTCAGGATTTCTCTGGACAAGATCCTAACATTTTACTGAGT
  CATCTTTTGGCCAGAATCTGGAAACCATACAAGAAACGTGAGACTCCTGATTGCTTCTGG
  AAATACTGTGTCTGAAGTGAAATAAGCATCTGTTAGTCAGCTCAGAAACACCCATCTTAG
  AATATGAAAAATAACACAATGCTTGATTTGAAAACAGTGTGGAGAAAAACTAGGCAAACT
  ACACCCTGTTCATTGTTACCTGGA
  
• Restriction Sites: Please inquire
• ACCN: NM_006786
• ORF Size: 375 bp
• Insert Size: 600
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_006786.2, NP_006777.1
• RefSeq Size: 558
• RefSeq ORF: 375
• Locus ID: 10911
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a mature peptide that is an active cyclic heptapeptide absolutely conserved from lamprey to human. The active peptide acts as a vasoconstrictor and is expressed only in brain tissue. Despite the gene family name similarity, this gene is not homologous to urocortin, a member of the sauvagine/corticotropin-releasing factor/urotensin I family. Most of the proprotein is cleaved to make the mature peptide. Transcript variants encoding different preproprotein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) encodes a shorter preproprotein isoform (b) of 124 amino acids with a different amino-terminal end compared to isoform a. The mature peptide is identical for both transcript variants.