MDM2 (NM_006878) Human Untagged Clone

CAT#: SC303836

MDM2 (untagged)-Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2a

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MDM2
• Synonyms: hdm2; HDMX; MGC5370; MGC71221
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_006878 edited
  ATGGTGAGGAGCAGGCAAATGTGCAATACCAACATGTCTGTACCTACTGATGGTGCTGTA
  ACCACCTCACAGATTCCAGCTTCGGAACAAGAGACCCTGGTTAGACCAAAGCCATTGCTT
  TTGAAGTTATTAAAGTCTGTTGGTGCACAAAAAGACACTTATACTATGAAAGAGGTTCTT
  TTTTATCTTGGCCAGTATATTATGACTAAACGATTATATGATGAGAAGCAACAACATATT
  GTATATTGTTCAAATGATCTTCTAGGAGATTTGTTTGGCGTGCCAAGCTTCTCTGTGAAA
  GAGCACAGGAAAATATATACCATGATCTACAGGAACTTGGTAGTAGTCAATCAGCAGGAA
  TCATCGGACTCAGGTACATCTGTGAGTGAGAACAGGTGTCACCTTGAAGGTGGGAGTGAT
  CAAAAGGACCTTGTACAAGAGCTTCAGGAAGAGAAACCTTCATCTTCACATTTGGTTTCT
  AGACCATCTACCTCATCTAGAAGGAGAGCAATTAGTGAGACAGAAGAAACCCAAGACAAA
  GAAGAGAGTGTGGAATCTAGTTTGCCCCTTAATGCCATTGAACCTTGTGTGATTTGTCAA
  GGTCGACCTAAAAATGGTTGCATTGTCCATGGCAAAACAGGACATCTTATGGCCTGCTTT
  ACATGTGCAAAGAAGCTAAAGAAAAGGAATAAGCCCTGCCCAGTATGTAGACAACCAATT
  CAAATGATTGTGCTAACTTATTTCCCCTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_006878
• Insert Size: 1200 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006878.2, NP_006869.3
• RefSeq Size: 1613 bp
• RefSeq ORF: 750 bp
• Locus ID: 4193
• Cytogenetics: 12q15
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Bladder cancer, Cell cycle, Chronic myeloid leukemia, Endocytosis, Glioma, Melanoma, p53 signaling pathway, Pathways in cancer, Prostate cancer, Ubiquitin mediated proteolysis
• Gene Summary: 'This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]'
  Transcript Variant: This variant (MDM2a) is expressed in lympocytes. It lacks an internal coding segment in the 3' region, as compared to variant MDM2. The resulting isoform MDM2a, also known as isoform KB9, lacks a nuclear localization signal and a zf-RanBP region, as compared to isoform MDM2.