CRYGD (NM_006891) Human Untagged Clone

CAT#: SC303845

CRYGD (untagged)-Human crystallin, gamma D (CRYGD)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRYGD
• Synonyms: CACA; CCA3; CCP; cry-g-D; CRYG4; CTRCT4; PCC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006891, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGAAGATCACCCTCTACGAGGACCGGGGCTTCCAGGGCCGCCACTATGAATGCAGCAGCGACCACC
  CCAACCTGCAGCCCTACTTGAGCCGCTGCAACTCGGCGCGCGTGGACAGCGGCTGCTGGATGCTCTATGA
  GCAGCCCAACTACTCGGGCCTCCAGTACTTCCTGCGCCGCGGCGACTATGCCGACCACCAGCAGTGGATG
  GGCCTCAGCGACTCGGTCCGCTCCTGCCGCCTCATCCCCCACTCTGGCTCTCACAGGATCAGACTCTATG
  AGAGAGAGGACTACAGAGGCCAGATGATAGAGTTCACTGAGGACTGCTCCTGTCTTCAGGACCGCTTCCG
  CTTCAATGAAATCCACTCCCTCAACGTGCTGGAGGGCTCCTGGGTCCTCTACGAGCTGTCCAACTACCGA
  GGACGGCAGTACCTGCTGATGCCAGGGGACTATAGGCGCTACCAGGACTGGGGGGCCACGAATGCCAGAG
  TGGGCTCTCTGAGGAGAGTCATAGATTTCTCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006891
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006891.3, NP_008822.2
• RefSeq Size: 724 bp
• RefSeq ORF: 525 bp
• Locus ID: 1421
• Cytogenetics: 2q33.3
• Protein Families: Druggable Genome
• Gene Summary: 'Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]'