CD94 (KLRD1) (NM_007334) Human Untagged Clone

CAT#: SC303912

KLRD1 (untagged)-Human killer cell lectin-like receptor subfamily D, member 1 (KLRD1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KLRD1
• Synonyms: CD94
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_007334, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGCTTTTACTAAACTGAGTATTGAGCCAGCATTTACTCCAGGACCCAACATAGAACTCCAGAAAG
  ACTCTGACTGCTGTTCTTGCCAAGAAAAATGGGTTGGGTACCGGTGCAACTGTTACTTCATTTCCAGTGA
  ACAGAAAACTTGGAACGAAAGTCGGCATCTCTGTGCTTCTCAGAAATCCAGCCTGCTTCAGCTTCAAAAC
  ACAGATGAACTGGATTTTATGAGCTCCAGTCAACAATTTTACTGGATTGGACTCTCTTACAGTGAGGAGC
  ACACCGCCTGGTTGTGGGAGAATGGCTCTGCACTCTCCCAGTATCTATTTCCATCATTTGAAACTTTTAA
  TACAAAGAACTGCATAGCGTATAATCCAAATGGAAATGCTTTAGATGAATCCTGTGAAGATAAAAATCGT
  TATATCTGTAAGCAACAGCTCATTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_007334
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_007334.2, NP_031360.1
• RefSeq Size: 3165 bp
• RefSeq ORF: 447 bp
• Locus ID: 3824
• Cytogenetics: 12p13.2
• Protein Families: Transmembrane
• Protein Pathways: Antigen processing and presentation, Graft-versus-host disease, Natural killer cell mediated cytotoxicity
• Gene Summary: 'Natural killer (NK) cells are a distinct lineage of lymphocytes that mediate cytotoxic activity and secrete cytokines upon immune stimulation. Several genes of the C-type lectin superfamily, including members of the NKG2 family, are expressed by NK cells and may be involved in the regulation of NK cell function. KLRD1 (CD94) is an antigen preferentially expressed on NK cells and is classified as a type II membrane protein because it has an external C terminus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2017]'
  Transcript Variant: This variant (2) encodes isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.