Claudin 17 (CLDN17) (NM_012131) Human Untagged Clone

CAT#: SC303929

CLDN17 (untagged)-Human claudin 17 (CLDN17)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN17
• Synonyms: MGC126552; MGC126554
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_012131 edited
  ATGGCATTTTATCCCTTGCAAATTGCTGGGCTGGTTCTTGGGTTCCTTGGCATGGTGGGG
  ACTCTTGCCACAACCCTTCTGCCTCAGTGGAGAGTATCAGCTTTTGTTGGCAGCAACATT
  ATTGTCTTTGAGAGGCTCTGGGAAGGGCTCTGGATGAATTGCATCCGACAAGCCAGGGTC
  CGGTTGCAATGCAAGTTCTATAGCTCCTTGTTGGCTCTCCCGCCTGCCCTGGAAACAGCC
  CGGGCCCTCATGTGTGTGGCTGTTGCTCTCTCCTTGATCGCCCTGCTTATTGGCATCTGT
  GGCATGAAGCAGGTCCAGTGCACAGGCTCTAACGAGAGGGCCAAAGCATACCTTCTGGGA
  ACTTCAGGAGTCCTCTTCATCCTGACGGGCATCTTCGTTCTGATTCCGGTGAGCTGGACA
  GCCAATATAATCATCAGAGATTTCTACAACCCAGCCATCCACATAGGTCAGAAACGAGAG
  CTGGGAGCAGCACTTTTCCTTGGCTGGGCAAGCGCTGCTGTCCTCTTCATTGGAGGGGGT
  CTGCTTTGTGGATTTTGCTGCTGCAACAGAAAGAAGCAAGGGTACAGATATCCAGTGCCT
  GGCTACCGTGTGCCACACACAGATAAGCGAAGAAATACGACAATGCTTAGTAAGACCTCC
  ACCAGTTATGTCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_012131
• ORF Size: 675 bp
• Insert Size: 700
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_012131.1, NP_036263.1
• RefSeq Size: 675
• RefSeq ORF: 675
• Locus ID: 26285
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and is clustered with CLDN8 on chromosome 21q22.11. [provided by RefSeq, Jun 2010]