IL17C (NM_013278) Human Untagged Clone

CAT#: SC303993

IL17C (untagged)-Human interleukin 17C (IL17C)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL17C
• Synonyms: CX2; IL-17C
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_013278, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACGCTCCTCCCCGGCCTCCTGTTTCTGACCTGGCTGCACACATGCCTGGCCCACCATGACCCCTCCC
  TCAGGGGGCACCCCCACAGTCACGGTACCCCACACTGCTACTCGGCTGAGGAACTGCCCCTCGGCCAGGC
  CCCCCCACACCTGCTGGCTCGAGGTGCCAAGTGGGGGCAGGCTTTGCCTGTAGCCCTGGTGTCCAGCCTG
  GAGGCAGCAAGCCACAGGGGGAGGCACGAGAGGCCCTCAGCTACGACCCAGTGCCCGGTGCTGCGGCCGG
  AGGAGGTGTTGGAGGCAGACACCCACCAGCGCTCCATCTCACCCTGGAGATACCGTGTGGACACGGATGA
  GGACCGCTATCCACAGAAGCTGGCCTTCGCCGAGTGCCTGTGCAGAGGCTGTATCGATGCACGGACGGGC
  CGCGAGACAGCTGCGCTCAACTCCGTGCGGCTGCTCCAGAGCCTGCTGGTGCTGCGCCGCCGGCCCTGCT
  CCCGCGACGGCTCGGGGCTCCCCACACCTGGGGCCTTTGCCTTCCACACCGAGTTCATCCACGTCCCCGT
  CGGCTGCACCTGCGTGCTGCCCCGTTCAGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_013278
• ORF Size: 594 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_013278.3, NP_037410.1
• RefSeq Size: 1048
• RefSeq ORF: 594
• Locus ID: 27189
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: The protein encoded by this gene is a T cell-derived cytokine that shares the sequence similarity with IL17. This cytokine was reported to stimulate the release of tumor necrosis factor alpha and interleukin 1 beta from a monocytic cell line. The expression of this cytokine was found to be restricted to activated T cells. [provided by RefSeq, Jul 2008]