ST8SIA5 (NM_013305) Human Untagged Clone

CAT#: SC303996

ST8SIA5 (untagged)-Human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 (ST8SIA5)


  "NM_013305" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ST8SIA5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ST8SIA5
Synonyms SIAT8-E; SIAT8E; ST8SiaV
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_013305, the custom clone sequence may differ by one or more nucleotides


ATGCGCTACGCGGACCCCTCGGCCAACCGGGATTTGTTGGGGAGCCGAACTTTGCTCTTCATCTTCATCT
GCGCCTTTGCCTTGGTGACCTTGCTGCAACAGATCCTGTATGGCAGGAACTACATTAAGAGGTACTTTGA
ATTTTATGAGGGGCCTTTTGAATATAACTCCACAAGATGCCTGGAGCTGAGGCACGAAATATTGGAAGTG
AAGGTGCTGTCCATGGTGAAGCAGTCAGAGCTGTTCGACAGGTGGAAGAGCCTCCAGATGTGCAAATGGG
CGATGAACATCTCTGAGGCCAACCAGTTCAAGTCTACTCTGTCCAGGTGCTGCAACGCCCCTGCCTTTCT
CTTCACCACCCAGAAGAACACTCCCCTGGGGACAAAGCTCAAGTATGAGGTGGACACCAGTGGCATCTAC
CACATCAACCAGGAGATCTTCCGCATGTTTCCCAAGGACATGCCCTACTACCGGTCCCAGTTTAAGAAGT
GTGCTGTAGTGGGCAACGGAGGCATCTTGAAGAACAGCCGCTGCGGGAGGGAGATCAACAGCGCCGACTT
CGTCTTCCGGTGCAACCTGCCCCCCATCTCAGAGAAGTACACCATGGATGTGGGGGTGAAGACGGATGTG
GTCACTGTGAACCCCAGCATCATCACAGAGAGGTTCCACAAGCTGGAGAAGTGGCGGCGGCCGTTCTATC
GCGTGCTGCAGGTGTACGAGAACGCGTCGGTGCTGCTGCCTGCCTTCTACAACACGCGCAACACCGACGT
GTCCATCCGCGTCAAGTACGTGCTGGACGACTTCGAATCGCCGCAAGCTGTCTACTACTTCCATCCGCAG
TACCTGGTCAACGTGTCGCGCTACTGGCTCAGCCTGGGGGTGCGCGCCAAGCGCATCAGCACCGGCCTCA
TTCTGGTCACTGCGGCGCTGGAGCTCTGTGAGGAGGTGCACCTCTTTGGCTTCTGGGCCTTCCCCATGAA
CCCCTCGGGCCTCTACATCACTCACCACTACTATGACAACGTCAAGCCGCGTCCCGGCTTCCACGCCATG
CCCTCTGAGATCTTCAACTTCCTGCACTTGCACAGCCGAGGCATCCTCCGCGTGCACACGGGCACCTGCA
GCTGCTGCTGA


Restriction Sites SgfI-RsrII     
ACCN NM_013305
ORF Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_013305.5, NP_037437.2
RefSeq Size 2720
RefSeq ORF 1131
Locus ID 29906
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - ganglio series, Metabolic pathways
Gene Summary The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.