OR10H1 (NM_013940) Human Untagged Clone

CAT#: SC304016

OR10H1 (untagged)-Human olfactory receptor, family 10, subfamily H, member 1 (OR10H1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OR10H1
• Synonyms: olfactory receptor, family 10, subfamily H, member 1; olfactory receptor OR19-27
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_013940, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGAGAGCCAATCACTCCACAGTGACCCAATTCATCCTCGTCGGCTTCTCTGTCTTCCCCCACCTCC
  AGCTGATGCTCTTCCTGCTGTTCCTGCTGATGTACCTGTTCACGCTGCTGGGCAACCTGCTCATCATGGC
  CACCGTCTGGAGCGAGCGCAGCCTCCACACGCCCATGTACCTCTTCCTGTGCGCCCTCTCCGTCTCCGAG
  ATCCTCTACACCGTGGCCATCATCCCGCGCATGCTGGCCGACCTGCTGTCCACCCAGCGCTCCATCGCCT
  TCCTGGCCTGTGCCAGTCAGATGTTCTTCTCCTTCAGCTTCGGCTTCACCCACTCCTTCCTGCTCACCGT
  CATGGGCTACGACCGCTACGTGGCCATCTGCCACCCCCTGCGCTACAACGTGCTCATGAGCCCGCGGGGC
  TGCGCCTGCCTGGTGGGCTGCTCCTGGGCTGGTGGCTTGGTCATGGGGATGGTGGTGACCTCGGCCATTT
  TCCACCTCGCCTTCTGTGGACACAAGGAGATCCACCATTTTGCTTGCCATGTGCCACCTCTGTTGAAGTT
  GGCCTGTGGAGACGATGTGCTGGTGGTGGCCAAAGGCGTGGGCTTGGTGTGTATCACGGCCCTGCTGGGC
  TGTTTTCTCCTCATCCTCCTCTCCTATGCCTTCATCGTGGCCGCCATCTTGAAGATCCCTTCTGCTGAAG
  GTCGGAACAAGGCCTTCTCCACCTGTGCCTCTCACCTCACTGTGGTGGTCGTGCACTATGGCTTTGCCTC
  CGTCATTTACCTGAAGCCCAAAAGTCCCCAGTCTCTGGAAGGAGACACCTTGATGGGCATCACCTACACG
  GTCCTCACACCCTTCCTCAGCCCCATCATCTTCAGCCTCAGGAACAAGGAGCTGAAGGTCGCCATGAAGA
  AGACCTTCTTCAGTAAACTCTACCCAGAAAAAAATGTAATGATGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_013940
• ORF Size: 957 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_013940.2, NP_039228.1
• RefSeq Size: 1120
• RefSeq ORF: 957
• Locus ID: 26539
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Olfactory transduction
• Gene Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]