Peroxiredoxin 3 (PRDX3) (NM_014098) Human Untagged Clone

CAT#: SC304039

PRDX3 (untagged)-Human peroxiredoxin 3 (PRDX3), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRDX3
• Synonyms: AOP-1; AOP1; HBC189; MER5; PRO1748; prx-III; SP-22
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_014098, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGACATGTGAGTGCCATTCCTTGGGGCA
  TTTCTGCCACTGCAGCCCTCAGGCCTGCTGCATGTGGAAGAACGAGCTTGACAAATTTATTGTGTTCTGG
  TTCCAGTCAAGCACCCTATTTTAAGGGTACAGCCGTTGTCAATGGAGAGTTCAAAGACCTAAGCCTTGAT
  GACTTTAAGGGGAAATATTTGGTGCTTTTCTTCTATCCTTTGGATTTCACCTTTGTGTGTCCTACAGAAA
  TTGTTGCTTTTAGTGACAAAGCTAACGAATTTCACGACGTGAACTGTGAAGTTGTCGCAGTCTCAGTGGA
  TTCCCACTTTAGCCATCTTGCCTGGATAAATACACCAAGAAAGAATGGTGGTTTGGGCCACATGAACATC
  GCACTCTTGTCAGACTTAACTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCTTG
  CACTAAGAGGTCTCTTCATAATTGACCCCAATGGAGTCATCAAGCATTTGAGCGTCAACGATCTCCCAGT
  GGGCCGAAGCGTGGAAGAAACCCTCCGCTTGGTGAAGGCGTTCCAGTATGTAGAAACACATGGAGAAGTC
  TGCCCAGCGAACTGGACACCGGATTCTCCTACGATCAAGCCAAGTCCAGCTGCTTCCAAAGAGTACTTTC
  AGAAGGTAAATCAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_014098
• ORF Size: 717 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_014098.3, NP_054817.2
• RefSeq Size: 1583
• RefSeq ORF: 717
• Locus ID: 10935
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a mitochondrial protein with antioxidant function. The protein is similar to the C22 subunit of Salmonella typhimurium alkylhydroperoxide reductase, and it can rescue bacterial resistance to alkylhydroperoxide in E. coli that lack the C22 subunit. The human and mouse genes are highly conserved, and they map to the regions syntenic between mouse and human chromosomes. Sequence comparisons with recently cloned mammalian homologs suggest that these genes consist of a family that is responsible for the regulation of cellular proliferation, differentiation and antioxidant functions. This family member can protect cells from oxidative stress, and it can promote cell survival in prostate cancer. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 3, 13 and 22. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (2) lacks an alternate in-frame segment compared to variant 1, resulting in an isoform (b) which is shorter than isoform a. Isoform b lacks the complete transit peptide found in isoform a, and may not be found in the mitochondrion.