KIR2DL2 (NM_014219) Human Untagged Clone
CAT#: SC304065
KIR2DL2 (untagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2 (KIR2DL2)
"NM_014219" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KIR2DL2 |
Synonyms | CD158b; CD158B1; NKAT-6; NKAT6; p58.2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_014219 edited
CAGACAGCACCATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGC AGGGGGCCTGGCCACATGAGGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTC GCCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCAGGTTTGAGC ACTTCCTTCTGCACAGAGAAGGGAAGTTTAAGGACACTTTGCACCTCATTGGAGAGCACC ATGATGGGGTCTCCAAAGCCAACTTCTCCATCGGTCCCATGATGCAAGACCTTGCAGGGA CCTACAGATGCTACGGTTCTGTTACTCACTCCCCCTATCAGTTGTCAGCTCCCAGTGACC CTCTGGACATCGTCATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCC CCACGGTTCTGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACA TGTACCATCTATCCAGGGAGGGGGAGGCCCATGAATGTAGGTTCTCTGCAGGGCCCAAGG TCAACGGAACATTCCAGGCCGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACA GATGCTTCGGCTCTTTCCGTGACTCTCCATACGAGTGGTCAAACTCGAGTGACCCACTGC TTGTTTCTGTCACAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCTA AAACCGGTAACCCCCGACACCTGCACATTCTGATTGGGACCTCAGTGGTCATCATCCTCT TCATCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAAAAAAATGCTGCGGTAA TGGACCAAGAGTCTGCAGGGAACAGAACAGCGAATAGCGAGGACTCTGATGAACAAGACC CTCAGGAGGTGACATACACACAGTTGAATCACTGCGTTTTCACACAGAGAAAAATCACTC GCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATATCATCGTGTACACGGAACTTCCAA ATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGA |
Restriction Sites | Please inquire |
ACCN | NM_014219 |
Insert Size | 1000 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | It is not a varient. ORF exactly matches with that of reference. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014219.1, NP_055034.1 |
RefSeq Size | 1572 bp |
RefSeq ORF | 1047 bp |
Locus ID | 3803 |
Cytogenetics | 19q13.4 |
Protein Families | Transmembrane |
Protein Pathways | Antigen processing and presentation, Graft-versus-host disease, Natural killer cell mediated cytotoxicity |
Gene Summary | 'Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224797 | KIR2DL2 (Myc-DDK-tagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2 (KIR2DL2) |
USD 420.00 |
|
RG224797 | KIR2DL2 (GFP-tagged) - Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2 (KIR2DL2) |
USD 460.00 |
|
RC224797L3 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2 (KIR2DL2), Myc-DDK-tagged |
USD 620.00 |
|
RC224797L4 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2 (KIR2DL2), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review