CACNG5 (NM_014404) Human Untagged Clone

CAT#: SC304095

CACNG5 (untagged)-Human calcium channel, voltage-dependent, gamma subunit 5 (CACNG5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CACNG5
• Synonyms: calcium channel, voltage-dependent, gamma subunit 5; MGC126656; MGC126682; neuronal voltage-gated calcium channel gamma-5 subunit; voltage-dependent calcium channel gamma-5 subunit
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_014404, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTGCCTGCGGGAGGAAGGCCCTGACCCTGCTGAGCAGTGTCTTTGCTGTCTGTGGCTTGGGCCTCC
  TGGGTATCGCGGTCAGCACCGACTACTGGCTGTACCTGGAGGAGGGTGTGATTGTGCCCCAGAACCAGAG
  CACCGAGATCAAGATGTCCCTGCACTCAGGCCTCTGGCGGGTCTGCTTCCTTGCAGGTGAGGAGCGGGGG
  CGTTGCTTCACCATAGAATATGTGATGCCCATGAACACCCAGCTGACATCCGAGTCCACGGTCAATGTTC
  TAAAGATGATCCGCTCAGCCACACCATTCCCTCTGGTCAGCCTCTTCTTCATGTTCATTGGGTTTATCCT
  GAACAACATCGGACACATCCGTCCCCACCGGACGATACTGGCCTTTGTCTCTGGCATCTTCTTTATCCTC
  TCAGGCCTCTCTCTCGTGGTGGGCCTGGTGCTCTACATCTCCAGCATCAACGATGAGATGCTCAACAGGA
  CCAAGGATGCAGAGACCTACTTCAACTACAAGTATGGGTGGTCGTTTGCCTTCGCCGCCATCTCCTTCCT
  TTTAACGGAGGTAAAGCCCGTCACCCTAAGTATGGATAGGCTGGGCCTGGGCACTGCCCCACTGAGCCGG
  GGAGAGTGGGGATGGGGGAGAAGGGACATTCCACAACCATTTTGGACCCCGGACCACCCACTCTACTTCC
  CTTCCTCATCCCAGAATGTGTCACTGTCTTACCTTTCTGGGTCTCCTCCGGCCAGGATGTCCCCAGGACC
  CTGCTCCTGTCCCCACGTCCACTTCCCACCCCACTCGAGCTGTGTCCTGTGCAGACCCCAGCCAAGGGAG
  ATGAGGCAGGCCCCAGCAGCGAGCCCATCCTCTGCTGTCTTCTCCCTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_014404
• ORF Size: 891 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_014404.1, NP_055219.1
• RefSeq Size: 891
• RefSeq ORF: 891
• Locus ID: 27091
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
• Gene Summary: The protein encoded by this gene is a type II transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type I TARP and a calcium channel gamma subunit. This gene is a susceptibility locus for schizophrenia and bipolar disorder. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region compared to variant 1, resulting in a frameshift. It encodes isoform b, which is longer and which has a distinct C-terminus compared to isoform a.