IL36 alpha (IL36A) (NM_014440) Human Untagged Clone

CAT#: SC304107

IL36A (untagged)-Human interleukin 1 family, member 6 (epsilon) (IL1F6)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL36A
• Synonyms: FIL1; FIL1(EPSILON); FIL1E; IL-1F6; IL1(EPSILON); IL1F6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_014440, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAAAAGCATTGAAAATTGACACACCTCAGCAGGGGAGCATTCAGGATATCAATCATCGGGTGTGGG
  TTCTTCAGGACCAGACGCTCATAGCAGTCCCGAGGAAGGACCGTATGTCTCCAGTCACTATTGCCTTAAT
  CTCATGCCGACATGTGGAGACCCTTGAGAAAGACAGAGGGAACCCCATCTACCTGGGCCTGAATGGACTC
  AATCTCTGCCTGATGTGTGCTAAAGTCGGGGACCAGCCCACACTGCAGCTGAAGGAAAAGGATATAATGG
  ATTTGTACAACCAACCCGAGCCTGTGAAGTCCTTTCTCTTCTACCACAGCCAGAGTGGCAGGAACTCCAC
  CTTCGAGTCTGTGGCTTTCCCTGGCTGGTTCATCGCTGTCAGCTCTGAAGGAGGCTGTCCTCTCATCCTT
  ACCCAAGAACTGGGGAAAGCCAACACTACTGACTTTGGGTTAACTATGCTGTTTTAA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_014440
• ORF Size: 477 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_014440.1, NP_055255.1
• RefSeq Size: 477
• RefSeq ORF: 477
• Locus ID: 27179
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: The protein encoded by this gene is a cytokine that can activate NF-kappa-B and MAPK signaling pathways to generate an inflammatory response. The encoded protein functions primarily in skin and demonstrates increased expression in psoriasis. In addition, decreased expression of this gene has been linked to a poor prognosis in both hepatocellular carcinoma and colorectal cancer patients. [provided by RefSeq, Nov 2015]