PLA2G2E (NM_014589) Human Untagged Clone

CAT#: SC304136

PLA2G2E (untagged)-Human phospholipase A2, group IIE (PLA2G2E)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PLA2G2E
• Synonyms: GIIE sPLA2; sPLA2-IIE
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_014589, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAATCTCCCCACGTGCTGGTGTTCCTTTGCCTCCTGGTGGCTCTGGTCACCGGGAACCTGGTTCAGT
  TTGGGGTGATGATCGAGAAGATGACAGGCAAGTCCGCCCTGCAGTACAACGACTATGGCTGTTACTGCGG
  CATCGGTGGCTCCCACTGGCCGGTGGACCAGACTGACTGGTGCTGCCACGCCCACGACTGCTGCTACGGG
  CGTCTGGAGAAGCTGGGCTGTGAGCCCAAACTGGAAAAGTATCTTTTCTCTGTCAGCGAACGTGGCATTT
  TCTGCGCCGGCAGGACCACCTGCCAGCGGCTGACCTGCGAGTGTGACAAGAGGGCTGCCCTCTGCTTTCG
  CCGCAACCTGGGCACCTACAACCGCAAATATGCCCATTATCCCAACAAGCTGTGCACCGGGCCCACCCCG
  CCCTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_014589
• ORF Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_014589.2, NP_055404.1
• RefSeq Size: 487
• RefSeq ORF: 429
• Locus ID: 30814
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
• Gene Summary: PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. Has a preference for arachidonic-containing phospholipids. [UniProtKB/Swiss-Prot Function]