Kallikrein 13 (KLK13) (NM_015596) Human Untagged Clone
CAT#: SC304334
KLK13 (untagged)-Human kallikrein-related peptidase 13 (KLK13)
"NM_015596" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KLK13 |
Synonyms | KLK-L4; KLKL4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_015596, the custom clone sequence may differ by one or more nucleotides
ATGTGGCCCCTGGCCCTAGTGATCGCCTCCCTGACCTTGGCCTTGTCAGGAGGTGTCTCCCAGGAGTCTT CCAAGGTTCTCAACACCAATGGGACCAGTGGGTTTCTCCCAGGTGGCTACACCTGCTTCCCCCACTCTCA GCCCTGGCAGGCTGCCCTACTAGTGCAAGGGCGGCTACTCTGTGGGGGAGTCCTGGTCCACCCCAAATGG GTCCTCACTGCCGCACACTGTCTAAAGGAGGGGCTCAAAGTTTACCTAGGCAAGCACGCCCTAGGGCGTG TGGAAGCTGGTGAGCAGGTGAGGGAAGTTGTCCACTCTATCCCCCACCCTGAATACCGGAGAAGCCCCAC CCACCTGAACCACGACCATGACATCATGCTTCTGGAGCTGCAGTCCCCGGTCCAGCTCACAGGCTACATC CAAACCCTGCCCCTTTCCCACAACAACCGCCTAACCCCTGGCACCACCTGTCGGGTGTCTGGCTGGGGCA CCACCACCAGCCCCCAGGTGAATTACCCCAAAACTCTACAATGTGCCAACATCCAACTTCGCTCAGATGA GGAGTGTCGTCAAGTCTACCCAGGAAAGATCACTGACAACATGTTGTGTGCCGGCACAAAAGAGGGTGGC AAAGACTCCTGTGAGGGTGACTCTGGGGGCCCCCTGGTCTGTAACAGAACACTGTATGGCATCGTCTCCT GGGGAGACTTCCCATGTGGGCAACCTGACCGGCCTGGTGTCTACACCCGTGTCTCAAGATACGTCCTGTG GATCCGTGAAACAATCCGAAAATATGAAACCCAGCAGCAAAAATGGTTGAAGGGCCCACAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_015596 |
ORF Size | 834 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_015596.1, NP_056411.1 |
RefSeq Size | 1258 |
RefSeq ORF | 834 |
Locus ID | 26085 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. [provided by RefSeq, Jan 2017] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210136 | KLK13 (Myc-DDK-tagged)-Human kallikrein-related peptidase 13 (KLK13) |
USD 420.00 |
|
RG210136 | KLK13 (GFP-tagged) - Human kallikrein-related peptidase 13 (KLK13) |
USD 460.00 |
|
RC210136L1 | Lenti ORF clone of Human kallikrein-related peptidase 13 (KLK13), Myc-DDK-tagged |
USD 768.00 |
|
RC210136L2 | Lenti ORF clone of Human kallikrein-related peptidase 13 (KLK13), mGFP tagged |
USD 620.00 |
|
RC210136L3 | Lenti ORF clone of Human kallikrein-related peptidase 13 (KLK13), Myc-DDK-tagged |
USD 620.00 |
|
RC210136L4 | Lenti ORF clone of Human kallikrein-related peptidase 13 (KLK13), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review