Kallikrein 13 (KLK13) (NM_015596) Human Untagged Clone

CAT#: SC304334

KLK13 (untagged)-Human kallikrein-related peptidase 13 (KLK13)


  "NM_015596" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLK13"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLK13
Synonyms KLK-L4; KLKL4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_015596, the custom clone sequence may differ by one or more nucleotides


ATGTGGCCCCTGGCCCTAGTGATCGCCTCCCTGACCTTGGCCTTGTCAGGAGGTGTCTCCCAGGAGTCTT
CCAAGGTTCTCAACACCAATGGGACCAGTGGGTTTCTCCCAGGTGGCTACACCTGCTTCCCCCACTCTCA
GCCCTGGCAGGCTGCCCTACTAGTGCAAGGGCGGCTACTCTGTGGGGGAGTCCTGGTCCACCCCAAATGG
GTCCTCACTGCCGCACACTGTCTAAAGGAGGGGCTCAAAGTTTACCTAGGCAAGCACGCCCTAGGGCGTG
TGGAAGCTGGTGAGCAGGTGAGGGAAGTTGTCCACTCTATCCCCCACCCTGAATACCGGAGAAGCCCCAC
CCACCTGAACCACGACCATGACATCATGCTTCTGGAGCTGCAGTCCCCGGTCCAGCTCACAGGCTACATC
CAAACCCTGCCCCTTTCCCACAACAACCGCCTAACCCCTGGCACCACCTGTCGGGTGTCTGGCTGGGGCA
CCACCACCAGCCCCCAGGTGAATTACCCCAAAACTCTACAATGTGCCAACATCCAACTTCGCTCAGATGA
GGAGTGTCGTCAAGTCTACCCAGGAAAGATCACTGACAACATGTTGTGTGCCGGCACAAAAGAGGGTGGC
AAAGACTCCTGTGAGGGTGACTCTGGGGGCCCCCTGGTCTGTAACAGAACACTGTATGGCATCGTCTCCT
GGGGAGACTTCCCATGTGGGCAACCTGACCGGCCTGGTGTCTACACCCGTGTCTCAAGATACGTCCTGTG
GATCCGTGAAACAATCCGAAAATATGAAACCCAGCAGCAAAAATGGTTGAAGGGCCCACAATAA


Restriction Sites SgfI-MluI     
ACCN NM_015596
ORF Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_015596.1, NP_056411.1
RefSeq Size 1258
RefSeq ORF 834
Locus ID 26085
Protein Families Druggable Genome, Secreted Protein
Gene Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. [provided by RefSeq, Jan 2017]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.