PPIL1 (NM_016059) Human Untagged Clone

CAT#: SC304377

PPIL1 (untagged)-Human peptidylprolyl isomerase (cyclophilin)-like 1 (PPIL1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPIL1
• Synonyms: CGI-124; CYPL1; hCyPX; PPIase
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_016059, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCAATTCCCCCAGATTCCTGGCAGCCACCCAACGTTTACTTGGAGACCAGCATGGGAATCATTG
  TGCTGGAGCTGTACTGGAAGCATGCTCCAAAGACCTGTAAGAACTTTGCTGAGTTGGCTCGTCGAGGTTA
  CTACAATGGCACAAAATTCCACAGAATTATCAAAGACTTCATGATCCAAGGAGGTGACCCAACAGGGACA
  GGTCGAGGTGGTGCATCTATCTATGGCAAACAGTTTGAAGATGAACTTCATCCAGACTTGAAATTCACGG
  GGGCTGGAATTCTCGCAATGGCCAATGCGGGGCCAGATACCAATGGCAGCCAGTTCTTTGTGACCCTCGC
  CCCCACCCAGTGGCTTGACGGCAAACACACCATTTTTGGCCGAGTGTGTCAGGGCATAGGAATGGTGAAT
  CGCGTGGGAATGGTAGAAACAAACTCCCAGGACCGCCCTGTGGACGACGTGAAGATCATTAAGGCATACC
  CTTCTGGGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_016059
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_016059.4, NP_057143.1
• RefSeq Size: 1750
• RefSeq ORF: 501
• Locus ID: 51645
• Protein Pathways: Spliceosome
• Gene Summary: This gene is a member of the cyclophilin family of peptidylprolyl isomerases (PPIases). The cyclophilins are a highly conserved, ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. Based on similarity to other PPIases, this protein could accelerate the folding of proteins and might catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. [provided by RefSeq, Jul 2008]