SPAG11B (NM_016512) Human Untagged Clone

CAT#: SC304426

SPAG11B (untagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant A


  "NM_016512" in other vectors (5)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SPAG11B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPAG11B
Synonyms EDDM2B; EP2; EP2C; EP2D; HE2; HE2C; SPAG11; SPAG11A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_016512, the custom clone sequence may differ by one or more nucleotides


ATGAGGCAACGATTGCTCCCGTCCGTCACCAGCCTTCTCCTTGTGGCCCTGCTGTTTCCAGGATCGTCTC
AAGCCAGACATGTGAACCACTCAGCCACTGAGGCTCTCGGAGAACTCAGGGAAAGAGCCCCTGGGCAAGG
CACAAACGGGTTTCAGCTGCTACGCCACGCAGTGAAACGGGACCTCTTACCACCGCGCACCCCACCTTAC
CAAGTGCACATCTCTCACCGGGAGGCTCGAGGACCCTCATTTAGGATCTGTGTGGACTTTTTAGGGCCTA
GATGGGCCAGGGGATGTTCCACCGGGAATTAG


Restriction Sites SgfI-MluI     
ACCN NM_016512
ORF Size 312 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_016512.3, NP_057596.1
RefSeq Size 794
RefSeq ORF 312
Locus ID 10407
Protein Families Secreted Protein
Gene Summary This gene encodes several androgen-dependent, epididymis-specific secretory proteins. The specific functions of these proteins have not been determined, but they are thought to be involved in sperm maturation. Some of the isoforms contain regions of similarity to beta-defensins, a family of antimicrobial peptides. The gene is located on chromosome 8p23 near the defensin gene cluster. Alternative splicing of this gene results in seven transcript variants encoding different isoforms. Two different N-terminal and five different C-terminal protein sequences are encoded by the splice variants. Two additional variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (A) is also called the alpha1 transcript. It lacks two internal exons and encodes an isoform (A) whose C-terminus is identical to that of isoform B encoded by variant B.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.