PSMC3IP (NM_016556) Human Untagged Clone

CAT#: SC304432

PSMC3IP (untagged)-Human PSMC3 interacting protein (PSMC3IP), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSMC3IP
• Synonyms: GT198; HOP2; HUMGT198A; ODG3; TBPIP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_016556, the custom clone sequence may differ by one or more nucleotides
  ATGAGTAAAGGCCGGGCAGAAGCTGCGGCGGGAGCCGCCGGGATCCTCCTGAGGTACCTG
  CAGGAGCAGAACCGGCCCTACAGCTCCCAGGATGTGTTCGGGAACCTACAGCGGGAACAC
  GGACTGGGCAAGGCGGTGGTGGTGAAGACGCTGGAGCAGCTGGCGCAACAAGGCAAGATC
  AAAGAGAAGATGTACGGCAAGCAGAAGATCTATTTTGCGGATCAGGACCAGTTTGACATG
  GTGAGTGATGCTGACCTTCAAGTCCTAGATGGCAAAATCGTGGCCCTCACTGCTAAGGTG
  CAGAGCTTGCAGCAGAGCTGCCGCTACATGGAGGCTGAGCTCAAGGAATTATCTAGTGCC
  CTGACCACACCAGAGATGCAGAAAGAAATCCAGGAGTTAAAGAAGGAATGCGCTGGCTAC
  AGAGAGAGATTGAAGAACATTAAAGCAGCTACCAATCATGTGACTCCAGAAGAGAAAGAG
  CAGGTGTACAGAGAGAGGCAGAAGTACTGTAAGGAGTGGAGGAAGAGGAAGAGGATGGCT
  ACAGAGCTGTCTGATGCAATACTTGAAGGATACCCCAAGAGCAAGAAGCAGTTCTTTGAG
  GAAGTTGGGATAGAGACGGATGAAGATTACAACGTCACACTCCCAGACCCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_016556
• ORF Size: 654 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_016556.1, NP_057640.1
• RefSeq Size: 1349
• RefSeq ORF: 654
• Locus ID: 29893
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein that functions in meiotic recombination. It is a subunit of the PSMC3IP/MND1 complex, which interacts with PSMC3/TBP1 to stimulate DMC1- and RAD51-mediated strand exchange during meiosis. The protein encoded by this gene can also co-activate ligand-driven transcription mediated by estrogen, androgen, glucocorticoid, progesterone, and thyroid nuclear receptors. Mutations in this gene cause XX female gonadal dysgenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (2) encodes the longest isoform (2).