KDELR3 (NM_016657) Human Untagged Clone

CAT#: SC304445

KDELR3 (untagged)-Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 (KDELR3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KDELR3
• Synonyms: ERD2L3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_016657, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACGTGTTCCGAATCCTCGGCGACCTGAGCCACCTCCTGGCCATGATCTTGCTGCTGGGGAAGATCT
  GGAGGTCCAAGTGCTGCAAGGGCATCTCTGGGAAGAGCCAGATCCTGTTTGCTCTCGTCTTCACCACCAG
  GTACCTGGACCTGTTCACCAACTTCATCTCCATCTACAACACAGTAATGAAGGTGGTTTTTCTCCTCTGT
  GCCTATGTTACAGTGTACATGATATATGGGAAATTCCGTAAAACTTTTGACAGTGAGAATGACACATTCC
  GCCTGGAGTTTCTTCTGGTCCCAGTCATTGGCCTTTCCTTCCTTGAAAACTACAGTTTCACTCTGCTGGA
  GATCCTCTGGACTTTCTCTATCTATCTGGAATCAGTGGCTATCCTGCCCCAGCTCTTCATGATCAGCAAG
  ACTGGAGAGGCTGAGACCATAACTACTCACTACCTGTTCTTTCTGGGTCTGTACCGGGCACTCTACCTGG
  CTAACTGGATCAGGCGGTACCAGACTGAGAATTTCTATGACCAAATTGCAGTCGTGTCTGGAGTAGTACA
  AACCATCTTCTACTGTGACTTCTTCTACTTGTATGTGACCAAAGGTAGGTCCTGGGATGACAGCAATGCT
  GACACTGGCCTAAGGAGTTACTCATCCATTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_016657
• ORF Size: 663 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_016657.2, NP_057839.1
• RefSeq Size: 960
• RefSeq ORF: 663
• Locus ID: 11015
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Vibrio cholerae infection
• Gene Summary: This gene encodes a member of the KDEL endoplasmic reticulum protein retention receptor family. Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR3 was the third member of the family to be identified. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform b which is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.