DEC1 (NM_017418) Human Untagged Clone
CAT#: SC304460
41609 (untagged)-Human deleted in esophageal cancer 1 (DEC1)
"NM_017418" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DEC1 |
Synonyms | CTS9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_017418, the custom clone sequence may differ by one or more nucleotides
ATGACAATGAATGTTCTGGAGGCTGGGAAGTGGAAGAGCATTGTGCCAGCACCTGGTGAGGGCCTTCTTG CCGTGTTACACATGATGGTTTTTACTGATGCCCTGCACAGAGAGAGGTCTGTAAAGTGGCAAGCAGGAGT CTGCTACAATGGAGGAAAGGATTTTGCTGTATCTCTTGCCAGGCCCAAGGCTGCAGAGGGAATTGCAGAT TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_017418 |
ORF Size | 213 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_017418.2, NP_059114.1 |
RefSeq Size | 1251 |
RefSeq ORF | 213 |
Locus ID | 50514 |
Gene Summary | The function of this gene is not known. This gene is located in a region commonly deleted in esophageal squamous cell carcinomas. Gene expression is reduced or absent in these carcinomas and thus this is a candidate tumor suppressor gene for esophageal squamous cell carcinomas. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213429 | DEC1 (Myc-DDK-tagged)-Human deleted in esophageal cancer 1 (DEC1) |
USD 98.00 |
|
RG213429 | 41609 (GFP-tagged) - Human deleted in esophageal cancer 1 (DEC1) |
USD 460.00 |
|
RC213429L3 | Lenti ORF clone of Human deleted in esophageal cancer 1 (DEC1), Myc-DDK-tagged |
USD 620.00 |
|
RC213429L4 | Lenti ORF clone of Human deleted in esophageal cancer 1 (DEC1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review