DEC1 (NM_017418) Human Untagged Clone

CAT#: SC304460

41609 (untagged)-Human deleted in esophageal cancer 1 (DEC1)


  "NM_017418" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DEC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DEC1
Synonyms CTS9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_017418, the custom clone sequence may differ by one or more nucleotides


ATGACAATGAATGTTCTGGAGGCTGGGAAGTGGAAGAGCATTGTGCCAGCACCTGGTGAGGGCCTTCTTG
CCGTGTTACACATGATGGTTTTTACTGATGCCCTGCACAGAGAGAGGTCTGTAAAGTGGCAAGCAGGAGT
CTGCTACAATGGAGGAAAGGATTTTGCTGTATCTCTTGCCAGGCCCAAGGCTGCAGAGGGAATTGCAGAT
TGA


Restriction Sites SgfI-MluI     
ACCN NM_017418
ORF Size 213 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_017418.2, NP_059114.1
RefSeq Size 1251
RefSeq ORF 213
Locus ID 50514
Gene Summary The function of this gene is not known. This gene is located in a region commonly deleted in esophageal squamous cell carcinomas. Gene expression is reduced or absent in these carcinomas and thus this is a candidate tumor suppressor gene for esophageal squamous cell carcinomas. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.