PPP1R14D (NM_017726) Human Untagged Clone

CAT#: SC304518

PPP1R14D (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14D (PPP1R14D), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP1R14D
• Synonyms: CPI17-like; GBPI-1; GBPI1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_017726, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGTCTTCAAGCCCTGCTTCCTGCACATCTCCCAGCCCAGATGGGGAGAACCCATGTAAGAAGGTCC
  ACTGGGCTTCTGGGAGGAGAAGGACATCATCCACAGACTCAGAGTCCAAGTCCCACCCGGACTCCTCCAA
  GATACCCAGGTCCCGGAGACCCAGCCGCCTGACAGTGAAGTATGACCGGGGCCAGCTCCAGCGCTGGCTG
  GAGATGGAGCAATGGGTGGATGCTCAAGTTCAGGAGCTCTTCCAGGATCAAGCAACCCCTTCTGAGCCTG
  AGATTGACCTGGAAGCTCTCATGGATCTATCCACAGAGGAGCAGAAGACTCAGCTGGAGGCCATTCTTGG
  GAACTGCCCCCGCCCCACAGAGGCTTTTATCTCTGAGCTGCTCAGTCAACTCAAGAAACTCCGGAGACTC
  AGCCGGCCTCAGAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_017726
• ORF Size: 438 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_017726.7, NP_060196.1
• RefSeq Size: 764
• RefSeq ORF: 438
• Locus ID: 54866
• Protein Families: Druggable Genome
• Gene Summary: Protein phosphatase-1 (PP1; see MIM 176875) is a major cellular phosphatase that reverses serine/threonine protein phosphorylation. PPP1R14D is a PP1 inhibitor that itself is regulated by phosphorylation (Liu et al., 2004 [PubMed 12974676]). [supplied by OMIM, Feb 2010]
  Transcript Variant: This variant (1) lacks an exon in the coding region, compared to variant 2, resulting in a frameshift and a protein (isoform 1) with a truncated C-terminus, compared to isoform 2.