PPP1R14D (NM_017726) Human Untagged Clone

CAT#: SC304518

PPP1R14D (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14D (PPP1R14D), transcript variant 1


  "NM_017726" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPP1R14D"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPP1R14D
Synonyms CPI17-like; GBPI-1; GBPI1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_017726, the custom clone sequence may differ by one or more nucleotides


ATGCTGTCTTCAAGCCCTGCTTCCTGCACATCTCCCAGCCCAGATGGGGAGAACCCATGTAAGAAGGTCC
ACTGGGCTTCTGGGAGGAGAAGGACATCATCCACAGACTCAGAGTCCAAGTCCCACCCGGACTCCTCCAA
GATACCCAGGTCCCGGAGACCCAGCCGCCTGACAGTGAAGTATGACCGGGGCCAGCTCCAGCGCTGGCTG
GAGATGGAGCAATGGGTGGATGCTCAAGTTCAGGAGCTCTTCCAGGATCAAGCAACCCCTTCTGAGCCTG
AGATTGACCTGGAAGCTCTCATGGATCTATCCACAGAGGAGCAGAAGACTCAGCTGGAGGCCATTCTTGG
GAACTGCCCCCGCCCCACAGAGGCTTTTATCTCTGAGCTGCTCAGTCAACTCAAGAAACTCCGGAGACTC
AGCCGGCCTCAGAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_017726
ORF Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_017726.7, NP_060196.1
RefSeq Size 764
RefSeq ORF 438
Locus ID 54866
Protein Families Druggable Genome
Gene Summary Protein phosphatase-1 (PP1; see MIM 176875) is a major cellular phosphatase that reverses serine/threonine protein phosphorylation. PPP1R14D is a PP1 inhibitor that itself is regulated by phosphorylation (Liu et al., 2004 [PubMed 12974676]). [supplied by OMIM, Feb 2010]
Transcript Variant: This variant (1) lacks an exon in the coding region, compared to variant 2, resulting in a frameshift and a protein (isoform 1) with a truncated C-terminus, compared to isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.