LENEP (NM_018655) Human Untagged Clone

CAT#: SC304619

LENEP (untagged)-Human lens epithelial protein (LENEP)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LENEP
• Synonyms: LEP503
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_018655, the custom clone sequence may differ by one or more nucleotides
  ATGCAGCCCCGGACACAGCCCCTAGCCCAAACCCTACCCTTCTTCCTCGGAGGGGCCCCT
  CGAGACACTGGGCTGCGGGTGCCTGTCATTAAGATGGGCACAGGGTGGGAGGGCTTCCAG
  CGGACCCTGAAGGAAGTCGCCTACATCCTCCTCTGCTGCTGGTGTATCAAGGAACTGCTG
  GATTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_018655
• ORF Size: 186 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_018655.2, NP_061125.1
• RefSeq Size: 671
• RefSeq ORF: 186
• Locus ID: 55891
• Gene Summary: The ocular lens is a tissue of epithelial origin and devoid of blood vessels and nerves. Cells of the lens epithelium are responsible for the growth and maintenance of the lens through mitosis, protein synthesis, and active transport of ions and metabolites across the lens capsule. Lens epithelial protein is expressed exclusively in lens epithelial cells and may play a role in cell differentiation. [provided by RefSeq, Jul 2008]