ACRV1 (NM_020108) Human Untagged Clone

CAT#: SC304700

ACRV1 (untagged)-Human acrosomal vesicle protein 1 (ACRV1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ACRV1
• Synonyms: D11S4365; SP-10; SPACA2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_020108, the custom clone sequence may differ by one or more nucleotides
  ATGAACAGGTTTCTCTTGCTAATGAGTCTTTATCTGCTTGGATCTGCCAGAGGAACATCA
  AGTCAGCCTAATGAGCTTTCTGGCTCCATAGATCATCAAACTTCAGTTCAGCAACTTCCA
  GGTGAGCAGCCTTCAGGAGAACAGCCTTCAGGTGAACACCTCTCCGGAGAACAGCCTTTG
  AGTGAGCTTGAGTCAGGTGAACAGCCTTCAGATGAACAGCCTTCAGGTGAACATGGCTCC
  GGTGAACAGCCTTCTGGTGAGCAGGCCTCGGGTGAACAGCCTTCAGGTGAGCACGCTTCA
  GGGGAACAGGCTTCAGGTGCACCAATTTCAAGCACATCTACAGGCACAATATTAAATTGC
  TACACATGTGCTTATATGAATGATCAAGGAAAATGTCTTCGTGGAGAGGGAACCTGCATC
  ACTCAGAATTCCCAGCAGTGCATGTTAAAGAAGATCTTTGAAGGTGGAAAACTCCAATTC
  ATGGTTCAAGGGTGTGAGAACATGTGCCCATCTATGAACCTCTTCTCCCATGGAACGAGG
  ATGCAAATTATATGCTGTCGAAATCAATCTTTCTGCAATAAGATCTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_020108
• ORF Size: 588 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_020108.3, NP_064493.1
• RefSeq Size: 1128
• RefSeq ORF: 588
• Locus ID: 56
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a testis-specific, differentiation antigen, acrosomal vesicle protein 1, that arises within the acrosomal vesicle during spermatogenesis, and is associated with the acrosomal membranes and matrix of mature sperm. The acrosomal vesicle protein 1 may be involved in sperm-zona binding or penetration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
  Transcript Variant: This variant (4) lacks a 210 nt fragment in exon II, which results in 70 aa fewer in isoform d, as compared to isoform a encoded by variant 1.