ACRV1 (NM_020108) Human Untagged Clone

CAT#: SC304700

ACRV1 (untagged)-Human acrosomal vesicle protein 1 (ACRV1), transcript variant 4


  "NM_020108" in other vectors (2)

Reconstitution Protocol

USD 420.00

Please Inquire*

Size
    • 10 ug

Product Images

Other products for "ACRV1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACRV1
Synonyms D11S4365; SP-10; SPACA2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_020108, the custom clone sequence may differ by one or more nucleotides
ATGAACAGGTTTCTCTTGCTAATGAGTCTTTATCTGCTTGGATCTGCCAGAGGAACATCA
AGTCAGCCTAATGAGCTTTCTGGCTCCATAGATCATCAAACTTCAGTTCAGCAACTTCCA
GGTGAGCAGCCTTCAGGAGAACAGCCTTCAGGTGAACACCTCTCCGGAGAACAGCCTTTG
AGTGAGCTTGAGTCAGGTGAACAGCCTTCAGATGAACAGCCTTCAGGTGAACATGGCTCC
GGTGAACAGCCTTCTGGTGAGCAGGCCTCGGGTGAACAGCCTTCAGGTGAGCACGCTTCA
GGGGAACAGGCTTCAGGTGCACCAATTTCAAGCACATCTACAGGCACAATATTAAATTGC
TACACATGTGCTTATATGAATGATCAAGGAAAATGTCTTCGTGGAGAGGGAACCTGCATC
ACTCAGAATTCCCAGCAGTGCATGTTAAAGAAGATCTTTGAAGGTGGAAAACTCCAATTC
ATGGTTCAAGGGTGTGAGAACATGTGCCCATCTATGAACCTCTTCTCCCATGGAACGAGG
ATGCAAATTATATGCTGTCGAAATCAATCTTTCTGCAATAAGATCTAG
Restriction Sites Please inquire     
ACCN NM_020108
ORF Size 588 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_020108.3, NP_064493.1
RefSeq Size 1128
RefSeq ORF 588
Locus ID 56
Protein Families Druggable Genome
Gene Summary This gene encodes a testis-specific, differentiation antigen, acrosomal vesicle protein 1, that arises within the acrosomal vesicle during spermatogenesis, and is associated with the acrosomal membranes and matrix of mature sperm. The acrosomal vesicle protein 1 may be involved in sperm-zona binding or penetration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (4) lacks a 210 nt fragment in exon II, which results in 70 aa fewer in isoform d, as compared to isoform a encoded by variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.