Claudin 2 (CLDN2) (NM_020384) Human Untagged Clone

CAT#: SC304755

CLDN2 (untagged)-Human claudin 2 (CLDN2), transcript variant 1


  "NM_020384" in other vectors (7)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CLDN2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLDN2
Synonyms SP82
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_020384, the custom clone sequence may differ by one or more nucleotides


ATGGCCTCTCTTGGCCTCCAACTTGTGGGCTACATCCTAGGCCTTCTGGGGCTTTTGGGCACACTGGTTG
CCATGCTGCTCCCCAGCTGGAAAACAAGTTCTTATGTCGGTGCCAGCATTGTGACAGCAGTTGGCTTCTC
CAAGGGCCTCTGGATGGAATGTGCCACACACAGCACAGGCATCACCCAGTGTGACATCTATAGCACCCTT
CTGGGCCTGCCCGCTGACATCCAGGCTGCCCAGGCCATGATGGTGACATCCAGTGCAATCTCCTCCCTGG
CCTGCATTATCTCTGTGGTGGGCATGAGATGCACAGTCTTCTGCCAGGAATCCCGAGCCAAAGACAGAGT
GGCGGTAGCAGGTGGAGTCTTTTTCATCCTTGGAGGCCTCCTGGGATTCATTCCTGTTGCCTGGAATCTT
CATGGGATCCTACGGGACTTCTACTCACCACTGGTGCCTGACAGCATGAAATTTGAGATTGGAGAGGCTC
TTTACTTGGGCATTATTTCTTCCCTGTTCTCCCTGATAGCTGGAATCATCCTCTGCTTTTCCTGCTCATC
CCAGAGAAATCGCTCCAACTACTACGATGCCTACCAAGCCCAACCTCTTGCCACAAGGAGCTCTCCAAGG
CCTGGTCAACCTCCCAAAGTCAAGAGTGAGTTCAATTCCTACAGCCTGACAGGGTATGTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_020384
ORF Size 693 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_020384.3, NP_065117.1
RefSeq Size 2998
RefSeq ORF 693
Locus ID 9075
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
Gene Summary This gene product belongs to the claudin protein family whose members have been identified as major integral membrane proteins localized exclusively at tight junctions. Claudins are expressed in an organ-specific manner and regulate tissue-specific physiologic properties of tight junctions. This protein is expressed in the intestine. Alternatively spliced transcript variants with different 5' untranslated region have been found for this gene. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant represents the predominant transcript. Variants 1-3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.