BCL2L10 (NM_020396) Human Untagged Clone

CAT#: SC304758

BCL2L10 (untagged)-Human BCL2-like 10 (apoptosis facilitator) (BCL2L10)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BCL2L10
• Synonyms: BCL-B; bcl2-L-10; Boo; Diva
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_020396 edited
  CCAAGAAAACCAGCGAAGGCCCGGCCCCCCAGCAGAGGCCGGACCATGGTTGACCAGTTG
  CGGGAGCGCACCACCATGGCCGACCCGCTGCGGGAGCGCACCGAGCTGTTGCTGGCCGAC
  TACCTGGGGTACTGCGCCCGGGAACCCGGCACCCCCGAGCCGGCGCCATCCACGCCCGAG
  GCCGCCGTGCTGCGCTCCGCGGCCGCCAGGTTACGGCAGATTCACCGGTCCTTTTTCTCC
  GCCTACCTCGGCTACCCCGGGAACCGCTTCGAGCTGGTGGCGCTGATGGCGGATTCCGTG
  CTCTCCGACAGCCCCGGCCCCACCTGGGGCAGAGTGGTGACGCTCGTGACCTTCGCAGGG
  ACGCTGCTGGAGAGAGGGCCGCTGGTGACCGCCCGGTGGAAGAAGTGGGGCTTCCAGCCG
  CGGCTAAAGGAGCAGGAGGGCGACGTCGCCCGGGACTGCCAGCGCCTGGTGGCCTTGCTG
  AGCTCGCGGCTCATGGGGCAGCACCGCGCCTGGCTGCAGGCTCAGGGCGGCTGGGATGGC
  TTTTGTCACTTCTTCAGGACCCCCTTTCCACTGGCTTTTTGGAGAAAACAGCTGGTCCAG
  GCTTTTCTGTCATGCTTGTTAACAACAGCCTTCATTTATCTCTGGACACGATTATTATGA
  GTTTTAAAACTTTTAACCCGCTTCTACCTGCCCAACTGTGACCAACTAAATGACAGATGT
  GTGAGAACAAGAACTGAGGGAAAGCACCTTCCCCCACCCCAGACGTTTTTATCTGAATGC
  ATACAAGGAGTCCTGAGGTGGTGATTTGGCCAGTGTTTTAACTTGTGACAAGTACTCAGG
  TGTGAGGACAAGAATGCAAATGGCTCTTCCTTGAGTGAAAGAA
  
• Restriction Sites: Please inquire
• ACCN: NM_020396
• ORF Size: 615 bp
• Insert Size: 900
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_020396.2.

Reference Data

• RefSeq: NM_020396.2, NP_065129.1
• RefSeq Size: 887
• RefSeq ORF: 615
• Locus ID: 10017
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains conserved BH4, BH1 and BH2 domains. This protein can interact with other members of BCL-2 protein family including BCL2, BCL2L1/BCL-X(L), and BAX. Overexpression of this gene has been shown to suppress cell apoptosis possibly through the prevention of cytochrome C release from the mitochondria, and thus activating caspase-3 activation. The mouse counterpart of this protein is found to interact with Apaf1 and forms a protein complex with Caspase 9, which suggests the involvement of this protein in APAF1 and CASPASE 9 related apoptotic pathway. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.