IL22 (NM_020525) Human Untagged Clone

CAT#: SC304781

IL22 (untagged)-Human interleukin 22 (IL22)


  "NM_020525" in other vectors (7)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "IL22"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IL22
Synonyms IL-21; IL-22; IL-D110; IL-TIF; ILTIF; TIFa; TIFIL-23; zcyto18
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene ORF sequence for NM_020525 edited
ATGGCCGCCCTGCAGAAATCTGTGAGCTCTTTCCTTATGGGGACCCTGGCCACCAGCTGC
CTCCTTCTCTTGGCCCTCTTGGTACAGGGAGGAGCAGCTGCGCCCATCAGCTCCCACTGC
AGGCTTGACAAGTCCAACTTCCAGCAGCCCTATATCACCAACCGCACCTTCATGCTGGCT
AAGGAGGCTAGCTTGGCTGATAACAACACAGACGTTCGTCTCATTGGGGAGAAACTGTTC
CACGGAGTCAGTATGAGTGAGCGCTGCTATCTGATGAAGCAGGTGCTGAACTTCACCCTT
GAAGAAGTGCTGTTCCCTCAATCTGATAGGTTCCAGCCTTATATGCAGGAGGTGGTGCCC
TTCCTGGCCAGGCTCAGCAACAGGCTAAGCACATGTCATATTGAAGGTGATGACCTGCAT
ATCCAGAGGAATGTGCAAAAGCTGAAGGACACAGTGAAAAAGCTTGGAGAGAGTGGAGAG
ATCAAAGCAATTGGAGAACTGGATTTGCTGTTTATGTCTCTGAGAAATGCCTGCATTTGA
Restriction Sites Please inquire     
ACCN NM_020525
ORF Size 540 bp
Insert Size 1200
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_020525.4, NP_065386.1
RefSeq Size 1147
RefSeq ORF 540
Locus ID 50616
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary This gene is a member of the IL10 family of cytokines that mediate cellular inflammatory responses. The encoded protein functions in antimicrobial defense at mucosal surfaces and in tissue repair. This protein also has pro-inflammatory properties and plays a role in in the pathogenesis of several intestinal diseases. [provided by RefSeq, Jul 2018]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.