IL22 (NM_020525) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL22 |
Synonyms | IL-21; IL-22; IL-D110; IL-TIF; ILTIF; TIFa; TIFIL-23; zcyto18 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene ORF sequence for NM_020525 edited
ATGGCCGCCCTGCAGAAATCTGTGAGCTCTTTCCTTATGGGGACCCTGGCCACCAGCTGC CTCCTTCTCTTGGCCCTCTTGGTACAGGGAGGAGCAGCTGCGCCCATCAGCTCCCACTGC AGGCTTGACAAGTCCAACTTCCAGCAGCCCTATATCACCAACCGCACCTTCATGCTGGCT AAGGAGGCTAGCTTGGCTGATAACAACACAGACGTTCGTCTCATTGGGGAGAAACTGTTC CACGGAGTCAGTATGAGTGAGCGCTGCTATCTGATGAAGCAGGTGCTGAACTTCACCCTT GAAGAAGTGCTGTTCCCTCAATCTGATAGGTTCCAGCCTTATATGCAGGAGGTGGTGCCC TTCCTGGCCAGGCTCAGCAACAGGCTAAGCACATGTCATATTGAAGGTGATGACCTGCAT ATCCAGAGGAATGTGCAAAAGCTGAAGGACACAGTGAAAAAGCTTGGAGAGAGTGGAGAG ATCAAAGCAATTGGAGAACTGGATTTGCTGTTTATGTCTCTGAGAAATGCCTGCATTTGA |
Restriction Sites | Please inquire |
ACCN | NM_020525 |
ORF Size | 540 bp |
Insert Size | 1200 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_020525.4, NP_065386.1 |
RefSeq Size | 1147 |
RefSeq ORF | 540 |
Locus ID | 50616 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | This gene is a member of the IL10 family of cytokines that mediate cellular inflammatory responses. The encoded protein functions in antimicrobial defense at mucosal surfaces and in tissue repair. This protein also has pro-inflammatory properties and plays a role in in the pathogenesis of several intestinal diseases. [provided by RefSeq, Jul 2018] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC321140 | IL22 (untagged)-Human interleukin 22 (IL22) |
USD 420.00 |
|
RC209995 | IL22 (Myc-DDK-tagged)-Human interleukin 22 (IL22) |
USD 98.00 |
|
RG209995 | IL22 (GFP-tagged) - Human interleukin 22 (IL22) |
USD 460.00 |
|
RC209995L1 | Lenti ORF clone of Human interleukin 22 (IL22), Myc-DDK-tagged |
USD 768.00 |
|
RC209995L2 | Lenti ORF clone of Human interleukin 22 (IL22), mGFP tagged |
USD 768.00 |
|
RC209995L3 | Lenti ORF clone of Human interleukin 22 (IL22), Myc-DDK-tagged |
USD 620.00 |
|
RC209995L4 | Lenti ORF clone of Human interleukin 22 (IL22), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review