FGF22 (NM_020637) Human Untagged Clone

CAT#: SC304788

FGF22 (untagged)-Human fibroblast growth factor 22 (FGF22)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FGF22
• Synonyms: fibroblast growth factor 22
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_020637 edited
  CGCCACCATGCGCCGCCGCCTGTGGCTGGGCCTGGCCTGGCTGCTGCTGGCGCGGGCGCC
  GGACGCCGCGGGAACCCCGAGCGCGTCGCGGGGACCGCGCAGCTACCCGCACCTGGAGGG
  CGACGTGCGCTGGCGGCGCCTCTTCTCCTCCACTCACTTCTTCCTGCGCGTGGATCCCGG
  CGGCCGCGTGCAGGGCACCCGCTGGCGCCACGGCCAGGACAGCATCCTGGAGATCCGCTC
  TGTACACGTGGGCGTCGTGGTCATCAAAGCAGTGTCCTCAGGCTTCTACGTGGCCATGAA
  CCGCCGGGGCCGCCTCTACGGGTCGCGACTCTACACCGTGGACTGCAGGTTCCGGGAGCG
  CATCGAAGAGAACGGCCACAACACCTACGCCTCACAGCGCTGGCGCCGCCGCGGCCAGCC
  CATGTTCCTGGCGCTGGACAGGAGGGGGGGGCCCCGGCCAGGCGGCCGGACGCGGCGGTA
  CCACCTGTCCGCCCACTTCCTGCCCGTCCTGGTCTCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_020637
• ORF Size: 513 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: It is not a varient.

Reference Data

• RefSeq: NM_020637.1, NP_065688.1
• RefSeq Size: 513
• RefSeq ORF: 513
• Locus ID: 27006
• Protein Families: Secreted Protein
• Protein Pathways: MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
• Gene Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The mouse homolog of this gene was found to be preferentially expressed in the inner root sheath of the hair follicle, which suggested a role in hair development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (1) encodes the longer isoform (1).