alpha 5 Defensin (DEFA5) (NM_021010) Human Untagged Clone

CAT#: SC304891

DEFA5 (untagged)-Human defensin, alpha 5, Paneth cell-specific (DEFA5)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFA5
• Synonyms: DEF5; HD-5
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_021010 edited
  TTCCACTCCTGCTCTCCCTCCTGCAGGTGACCCCAGCCATGAGGACCATCGCCATCCTTG
  CTGCCATTCTCCTGGTGGCCCTGCAGGCCCAGGCTGAGTCACTCCAGGAAAGAGCTGATG
  AGGCTACAACCCAGAAGCAGTCTGGGGAAGACAACCAGGACCTTGCTATCTCCTTTGCAG
  GAAATGGACTCTCTGCTCTTAGAACCTCAGGTTCTCAGGCAAGAGCCACCTGCTATTGCC
  GAACTGGCCGTTGTGCTACCC:GTGAGTCCCTCTCCGGGGTGTGTGAAATCAGTGGCCGC
  CTCTACAGACTCTGCTGTCGCTGAGCTTCCTAGATAGAAACCAAAGCAGTGCAAGATTCA
  GTTCAAGGTCCTGAAAAAAGAAAAACATTTTACTCTGTGTACCTTGTGTCTTTCTAAATT
  TCTCTCTCCAAAATAAAGTTCAAGCA
  
• Restriction Sites: Please inquire
• ACCN: NM_021010
• Insert Size: 440 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021010.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021010.1, NP_066290.1
• RefSeq Size: 449 bp
• RefSeq ORF: 285 bp
• Locus ID: 1670
• Cytogenetics: 8p23.1
• Protein Families: Secreted Protein
• Gene Summary: 'Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several of the alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 5, is highly expressed in the secretory granules of Paneth cells of the ileum. [provided by RefSeq, Oct 2014]'