MAGEA5 (NM_021049) Human Untagged Clone
CAT#: SC304898
MAGEA5 (untagged)-Human melanoma antigen family A, 5 (MAGEA5)
"NM_021049" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAGEA5 |
Synonyms | CT1.5; MAGE5; MAGEA4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_021049 edited
ATGTCTCTTGAGCAGAAGAGTCAGCACTGCAAGCCTGAGGAAGGCCTTGACACCCAAGAA GAGGCCCTGGGCCTGGTGGGTGTGCAGGCTGCCACTACTGAGGAGCAGGAGGCTGTGTCC TCCTCCTCTCCTCTGGTCCCAGGCACCCTGGGGGAGGTGCCTGCTGCTGGGTCACCAGGT CCTCTCAAGAGTCCTCAGGGAGCCTCCGCCATCCCCACTGCCATCGATTTCACTCTATGG AGGCAATCCATTAAGGGCTCCAGCAACCAAGAAGAGGAGGGGCCAAGCACCTCCCCTGAC CCAGAGTCTGTGTTCCGAGCAGCACTCAGTAAGAAGGTGGCTGACTTGATTCATTTTCTG CTCCTCAAGTATTAA |
Restriction Sites | Please inquire |
ACCN | NM_021049 |
Insert Size | 375 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced, and found to be a perfect match to the published NM_021049.3. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021049.3, NP_066387.1 |
RefSeq Size | 1692 bp |
RefSeq ORF | 375 bp |
Locus ID | 4104 |
Cytogenetics | Xq28 |
Gene Summary | 'This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This MAGEA gene encodes a protein that is C-terminally truncated compared to other family members, and this gene can be alternatively interpreted to be a pseudogene. The protein is represented in this Gene record in accordance with the assumed protein-coding status defined in the literature. Read-through transcription exists between this gene and the upstream melanoma antigen family A, 10 (MAGEA10) gene. [provided by RefSeq, Oct 2011]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218575 | MAGEA5 (Myc-DDK-tagged)-Human melanoma antigen family A, 5 (MAGEA5) |
USD 420.00 |
|
RG218575 | MAGEA5 (GFP-tagged) - Human melanoma antigen family A, 5 (MAGEA5) |
USD 460.00 |
|
RC218575L3 | Lenti ORF clone of Human melanoma antigen family A, 5 (MAGEA5), Myc-DDK-tagged |
USD 620.00 |
|
RC218575L4 | Lenti ORF clone of Human melanoma antigen family A, 5 (MAGEA5), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review