G6PC2 (NM_021176) Human Untagged Clone

CAT#: SC304916

G6PC2 (untagged)-Human glucose-6-phosphatase, catalytic, 2 (G6PC2), transcript variant 1


  "NM_021176" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "G6PC2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol G6PC2
Synonyms IGRP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021176, the custom clone sequence may differ by one or more nucleotides


ATGGATTTCCTTCACAGGAATGGAGTGCTCATAATTCAGCATTTGCAGAAGGACTACCGAGCTTACTACA
CTTTTCTAAATTTTATGTCCAATGTTGGAGACCCCAGGAATATCTTTTTCATTTATTTTCCACTTTGTTT
TCAATTTAATCAGACAGTTGGAACCAAGATGATATGGGTAGCAGTCATTGGGGATTGGTTAAATCTTATA
TTTAAATGGATATTATTTGGTCATCGACCTTACTGGTGGGTCCAAGAAACTCAGATTTACCCAAATCACT
CAAGTCCATGCCTTGAACAGTTCCCTACTACATGTGAAACAGGTCCAGGAAGTCCATCTGGCCATGCAAT
GGGCGCATCCTGTGTCTGGTATGTCATGGTAACCGCTGCCCTGAGCCACACTGTCTGTGGGATGGATAAG
TTCTCTATCACTCTGCACAGACTGACCTGGTCATTTCTTTGGAGTGTTTTTTGGTTGATTCAAATCAGTG
TCTGCATCTCCAGAGTATTCATAGCAACACATTTTCCTCATCAAGTTATTCTTGGAGTAATTGGTGGCAT
GCTGGTGGCAGAGGCCTTTGAACACACTCCAGGCATCCAAACGGCCAGTCTGGGCACATACCTGAAGACC
AACCTCTTTCTCTTCCTGTTTGCAGTTGGCTTTTACCTGCTTCTTAGGGTGCTCAACATTGACCTGCTGT
GGTCCGTGCCCATAGCCAAAAAGTGGTGTGCTAACCCCGACTGGATCCACATTGACACCACGCCTTTTGC
TGGACTCGTGAGAAACCTTGGGGTCCTCTTTGGCTTGGGCTTTGCAATCAACTCAGAGATGTTCCTCCTG
AGCTGCCGAGGGGGAAATAACTACACACTGAGCTTCCGGTTGCTCTGTGCCTTGACCTCATTGACAATAC
TGCAGCTCTACCATTTCCTCCAGATCCCGACTCACGAAGAGCATTTATTTTATGTGCTGTCTTTTTGTAA
AAGTGCATCCATTCCCCTAACTGTGGTTGCTTTCATTCCCTACTCTGTTCATATGTTAATGAAACAAAGC
GGAAAGAAGAGTCAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_021176
ORF Size 1068 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_021176.2, NP_066999.1
RefSeq Size 3096
RefSeq ORF 1068
Locus ID 57818
Protein Families Druggable Genome, Transmembrane
Protein Pathways Adipocytokine signaling pathway, Galactose metabolism, Glycolysis / Gluconeogenesis, Insulin signaling pathway, Metabolic pathways, Starch and sucrose metabolism
Gene Summary This gene encodes an enzyme belonging to the glucose-6-phosphatase catalytic subunit family. These enzymes are part of a multicomponent integral membrane system that catalyzes the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, allowing the release of glucose into the bloodstream. The family member encoded by this gene is found in pancreatic islets and does not exhibit phosphohydrolase activity, but it is a major target of cell-mediated autoimmunity in diabetes. Several alternatively spliced transcript variants of this gene have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.