DNASE2B (NM_021233) Human Untagged Clone

CAT#: SC304928

DNASE2B (untagged)-Human deoxyribonuclease II beta (DNASE2B), transcript variant 1


  "NM_021233" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DNASE2B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DNASE2B
Synonyms DLAD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021233, the custom clone sequence may differ by one or more nucleotides


ATGAAACAGAAAATGATGGCAAGACTGCTAAGAACATCCTTTGCTTTGCTCTTCCTTGGCCTCTTTGGGG
TGCTGGGGGCAGCAACAATTTCATGCAGAAATGAAGAAGGGAAAGCTGTGGACTGGTTTACTTTTTATAA
GTTACCTAAAAGACAAAACAAGGAAAGTGGAGAGACTGGGTTAGAGTACCTGTACCTAGACTCTACAACT
AGAAGCTGGAGGAAGAGTGAGCAACTAATGAATGACACCAAGAGTGTTTTGGGAAGGACATTACAACAGC
TATATGAAGCATATGCCTCTAAGAGTAACAACACAGCCTATCTAATATACAATGATGGAGTCCCTAAACC
TGTGAATTACAGCAGAAAGTATGGACACACCAAAGGTTTACTGCTGTGGAACAGAGTTCAAGGGTTCTGG
CTGATTCATTCCATCCCTCAGTTTCCTCCAATTCCGGAAGAAGGCTATGATTATCCACCCACAGGGAGAC
GAAATGGACAAAGTGGCATCTGCATAACTTTCAAGTACAACCAGTATGAGGCAATAGATTCTCAGCTCTT
GGTCTGCAACCCCAACGTCTATAGCTGCTCCATCCCAGCCACCTTTCACCAGGAGCTCATTCACATGCCC
CAGCTGTGCACCAGGGCCAGCTCATCAGAGATTCCTGGCAGGCTCCTCACCACACTTCAGTCGGCCCAGG
GACAAAAATTCCTCCATTTTGCAAAGTCGGATTCTTTTCTTGACGACATCTTTGCAGCCTGGATGGCTCA
ACGGCTGAAGACACACTTGTTAACAGAAACCTGGCAGCGAAAAAGACAAGAGCTTCCTTCAAACTGCTCC
CTTCCTTACCATGTCTACAATATAAAAGCAATTAAATTATCACGACACTCTTATTTCAGTTCTTATCAAG
ATCATGCCAAGTGGTGTATTTCCCAAAAGGGCACCAAAAATCGCTGGACATGTATTGGAGACCTAAATCG
GAGTCCACACCAAGCCTTCAGAAGTGGAGGATTCATTTGTACCCAGAATTGGCAAATTTACCAAGCATTT
CAAGGATTAGTATTATACTATGAAAGCTGTAAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_021233
ORF Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_021233.2, NP_067056.2
RefSeq Size 1279
RefSeq ORF 1086
Locus ID 58511
Protein Families Transmembrane
Protein Pathways Lysosome
Gene Summary The protein encoded by this gene shares considerable sequence similarity to, and is structurally related to DNase II. The latter is a well characterized endonuclease that catalyzes DNA hydrolysis in the absence of divalent cations at acidic pH. Unlike DNase II which is ubiquitously expressed, expression of this gene product is restricted to the salivary gland and lungs. The gene has been localized to chromosome 1p22.3 adjacent (and in opposite orientation) to the uricase pseudogene. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) is the full-length transcript and encodes the longer isoform (1), which is more highly expressed in the salivary gland.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.