LY6G6D (NM_021246) Human Untagged Clone

CAT#: SC304931

LY6G6D (untagged)-Human lymphocyte antigen 6 complex, locus G6D (LY6G6D)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LY6G6D
• Synonyms: C6orf23; G6D; LY6-D; MEGT1; NG25
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_021246 edited
  AACAATGAAACCCCAGTTTGTTGGGATCTTGCTCAGCTCCCTGCTAGGGGCTGCCTTGGG
  AAACCGAATGCGGTGCTACAACTGTGGTGGAAGCCCCAGCAGTTCTTGCAAAGAGGCCGT
  GACCACCTGTGGCGAGGGCAGACCCCAGCCAGGCCTGGAACAGATCAAGCTACCTGGAAA
  CCCCCCAGTGACCTTGATTCACCAACATCCAGCCTGCGTCGCAGCCCATCATTGCAATCA
  AGTGGAGACAGAGTCGGTGGGAGACGTGACTTATCCAGCCCACAGGGACTGCTACCTGGG
  AGACCTGTGCAACAGCGCCGTGGCAAGCCATGTGGCCCCTGCAGGCATTTTGGCTGCAGC
  AGCTACCGCCCTGACCTGTCTCTTGCCAGGACTGTGGAGCGGATAG
  
• Restriction Sites: Please inquire
• ACCN: NM_021246
• ORF Size: 402 bp
• Insert Size: 400
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021246.2.

Reference Data

• RefSeq: NM_021246.2, NP_067069.2
• RefSeq Size: 402
• RefSeq ORF: 402
• Locus ID: 58530
• Gene Summary: LY6G6D belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]). [supplied by OMIM, Apr 2009]
  Transcript Variant: This variant (1) encodes the longer isoform (1).