CD79A (NM_021601) Human Untagged Clone

CAT#: SC304940

CD79A (untagged)-Human CD79a molecule, immunoglobulin-associated alpha (CD79A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD79A
• Synonyms: IGA; MB-1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_021601 edited
  ATGCCTGGGGGTCCAGGAGTCCTCCAAGCTCTGCCTGCCACCATCTTCCTCCTCTTCCTG
  CTGTCTGCTGTCTACCTGGGCCCTGGGTGCCAGGCCCTGTGGATGCACAAGGTCCCAGCA
  TCATTGATGGTGAGCCTGGGGGAAGACGCCCACTTCCAATGCCCGCACAATAGCAGCAAC
  AACGCCAACGTCACCTGGTGGCGCGTCCTCCATGGCAACTACACGTGGCCCCCTGAGTTC
  TTGGGCCCGGGCGAGGACCCCAATGAGCCGCCCCCCAGGCCCTTCCTGGACATGGGGGAG
  GGCACCAAGAACCGAATCATCACAGCCGAGGGGATCATCCTCCTGTTCTGCGCGGTGGTG
  CCTGGGACGCTGCTGCTGTTCAGGAAACGATGGCAGAACGAGAAGCTCGGGTTGGATGCC
  GGGGATGAATATGAAGATGAAAACCTTTATGAAGGCCTGAACCTGGACGACTGCTCCATG
  TATGAGGACATCTCCCGGGGCCTCCAGGGCACCTACCAGGATGTGGGCAGCCTCAACATA
  GGAGATGTCCAGCTGGAGAAGCCGTGACACCCCTACTCCTGCCAGGCTGCCCCCGCCTGC
  TGTGCACCCAGCTCCAGTGTCTCAGCTCACTTAAGGC
  
• Restriction Sites: Please inquire
• ACCN: NM_021601
• Insert Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021601.2.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021601.2, NP_067612.1
• RefSeq Size: 1132 bp
• RefSeq ORF: 567 bp
• Locus ID: 973
• Cytogenetics: 19q13.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: B cell receptor signaling pathway, Primary immunodeficiency
• Gene Summary: 'The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-alpha protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.