CD79B (NM_021602) Human Untagged Clone

CAT#: SC304941

CD79B (untagged)-Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD79B
• Synonyms: AGM6; B29; IGB
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_021602 edited
  CAGAGCGGTGACCATGGCCAGGCTGGCGTTGTCTCCTGTGCCCAGCCACTGGATGGTGGC
  GTTGCTGCTGCTGCTCTCAGCTGAGCCAGTACCAGCAGCCAGATCGGAGGACCGGTACCG
  GAATCCCAAAGGATTCAGCACCTTGGCACAGCTGAAGCAGAGGAACACGCTGAAGGATGG
  TATCATCATGATCCAGACGCTGCTGATCATCCTCTTCATCATCGTGCCTATCTTCCTGCT
  GCTGGACAAGGATGACAGCAAGGCTGGCATGGAGGAAGATCACACCTACGAGGGCCTGGA
  CATTGACCAGACAGCCACCTATGAGGACATAGTGACGCTGCGGACAGGGGAAGTGAAGTG
  GTCTGTAGGTGAGCACCCAGGCCAGGAGTGAGAGCCAGGTCGCCCCATGACCTGGGTGCA
  GGCTCCCTGGCCTCAGTGACTGCTTCGGAGCTGCCTGGCTCATGGCCCAACCCCTTTCCC
  GGACCCCCCAGCTGGCCTCTGAAGCTGGCCCACCAGAGCTGCCATTTGTCTCCAGCCCCT
  GGTGTCCAGCTCTTGCCAAAGGGCCTGGAGTAGAAGGACAACAGGGCAGCAACTTGGAGG
  GAGTTCTCTGGGGATGGACGGGACCCAGCCTTCTGGGGGTGCTATGAGGTGATCCGTCCC
  CACACATGGGATGGGGGAGGCAGAGACTGGTCCAGAGCCCGCAAATGGACTCGGAGCCGA
  GGGCCTCCCAGCAGAGCTTGGGAAGGGCCATGGACCCAACTGGGCCCCAGAAGAGCCACA
  GGAACATCATTCCTCTCCCGCAACCACTCCCACCCCAGGGAGGCCCTGGCCTCCAGTGCC
  TTCCCCCGTGGAATAAACGGTGTGTCCTGAGAAACCAAAAAAAAAAAAAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_021602
• Insert Size: 900 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021602.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021602.1, NP_067613.1
• RefSeq Size: 958 bp
• RefSeq ORF: 378 bp
• Locus ID: 974
• Cytogenetics: 17q23.3
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: B cell receptor signaling pathway
• Gene Summary: 'The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site and also lacks an exon in the coding region, compared to variant 3. The encoded isoform (2) is shorter compared to isoform 3, but has identical N- and C- termini.