IL21 (NM_021803) Human Untagged Clone

CAT#: SC304958

IL21 (untagged)-Human interleukin 21 (IL21), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL21
• Synonyms: CVID11; IL-21; Za11
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_021803 edited
  GCCACCATGAGATCCAGTCCTGGCAACATGGAGAGGATTGTCATCTGTCTGATGGTCATC
  TTCTTGGGGACACTGGTCCACAAATCAAGCTCCCAAGGTCAAGATCGCCACATGATTAGA
  ATGCGTCAACTTATAGATATTGTTGATCAGCTGAAAAATTATGTGAATGACTTGGTCCCT
  GAATTTCTGCCAGCTCCAGAAGATGTAGAGACAAACTGTGAGTGGTCAGCTTTTTCCTGC
  TTTCAGAAGGCCCAACTAAAGTCAGCAAATACAGGAAACAATGAAAGGATAATCAATGTA
  TCAATTAAAAAGCTGAAGAGGAAACCACCTTCCACAAATGCAGGGAGAAGACAGAAACAC
  AGACTAACATGCCCTTCATGTGATTCTTATGAGAAAAAACCACCCAAAGAATTCCTAGAA
  AGATTCAAATCACTTCTCCAAAAGATGATTCATCAGCATCTGTCCTCTAGAACACACGGA
  AGTGAAGATTCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_021803
• ORF Size: 489 bp
• Insert Size: 500
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_021803.1, NP_068575.1
• RefSeq Size: 642
• RefSeq ORF: 489
• Locus ID: 59067
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
• Gene Summary: This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.