Secretin (SCT) (NM_021920) Human Untagged Clone

CAT#: SC304969

SCT (untagged)-Human secretin (SCT)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SCT
• Synonyms: secretin
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_021920 edited
  ATGGCCCCCCGGCCCCTCCTCCTGCTGCTGCTGCTCCTCGGGGGCTCCGCCGCGCGCCCC
  GCGCCCCCCAGGGCCCGGCGACACTCAGACGGGACGTTCACCAGCGAGCTCAGCCGCCTG
  CGGGAGGGCGCGCGGCTCCAGCGGCTGCTACAGGGCCTGGTGGGGAAGCGCAGCGAGCAG
  GACGCAGAGAACAGCATGGCCTGGACCAGGCTCAGCGCGGGTCTGCTCTGCCCGTCAGGG
  TCCAACATGCCCATCCTGCAGGCCTGGATGCCCCTGGACGGGACCTGGTCTCCCTGGCTG
  CCCCCTGGGCCTATGGTTTCAGAACCAGCTGGCGCTGCTGCAGAAGGAACCTTGCGGCCC
  AGATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_021920
• Insert Size: 500 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021920.2.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021920.2, NP_068739.1
• RefSeq Size: 514 bp
• RefSeq ORF: 366 bp
• Locus ID: 6343
• Cytogenetics: 11p15.5
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'This gene encodes a member of the glucagon family of peptides. The encoded preproprotein is secreted by endocrine S cells in the proximal small intestinal mucosa as a prohormone, then proteolytically processed to generate the mature peptide hormone. The release of this active peptide hormone is stimulated by either fatty acids or acidic pH in the duodenum. This hormone stimulates the secretion of bile and bicarbonate in the duodenum, pancreatic and biliary ducts. [provided by RefSeq, Feb 2016]'