Urotensin II (UTS2) (NM_021995) Human Untagged Clone
CAT#: SC304981
UTS2 (untagged)-Human urotensin 2 (UTS2), transcript variant 1
"NM_021995" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UTS2 |
Synonyms | PRO1068; U-II; UCN2; UII |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_021995 edited
GGGATGGCAGCCCTAAACACAGCATGGCAACTCATCTACTCACTCATGAAAGATTAAAAA ATGGAAACCAACGTATTTCATCTTATGCTCTGCGTCACTTCTGCTCGGACTCATAAATCC ACGTCTCTTTGCTTTGGCCACTTCAACTCATATCCAAGCCTTCCTTTAATTCATGATTTA TTGCTGGAAATATCCTTTCAACTCTCAGCACCTCATGAAGACGCGCGCTTAACTCCGGAG GAGCTAGAAAGAGCTTCCCTTCTACAGATACTGCCAGAGATGCTGGGTGCAGAAAGAGGG GATATTCTCAGGAAAGCAGACTCAAGTACCAACATTTTTAACCCAAGAGGAAATTTGAGA AAGTTTCAGGATTTCTCTGGACAAGATCCTAACATTTTACTGAGTCATCTTTTGGCCAGA ATCTGGAAACCATACAAGAAACGTGAGACTCCTGATTGCTTCTGGAAATACTGTGTCTGA AGTGAAATAAGCATCTGTTAGTCAGCTCAGAAACACCCATCTTAGAATATGAAAAATAAC ACAATGCTTGATTTGAAAACAGTGTGGAGAAAAACTAGGCAAACTACACCCTGTTCATTG TTACCTGGA |
Restriction Sites | Please inquire |
ACCN | NM_021995 |
ORF Size | 420 bp |
Insert Size | 600 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_021995.1, NP_068835.1 |
RefSeq Size | 652 |
RefSeq ORF | 420 |
Locus ID | 10911 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a mature peptide that is an active cyclic heptapeptide absolutely conserved from lamprey to human. The active peptide acts as a vasoconstrictor and is expressed only in brain tissue. Despite the gene family name similarity, this gene is not homologous to urocortin, a member of the sauvagine/corticotropin-releasing factor/urotensin I family. Most of the proprotein is cleaved to make the mature peptide. Transcript variants encoding different preproprotein isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes a longer preproprotein isoform (a) of 139 amino acids with a different amino-terminal end compared to isoform b. The mature peptide is identical for both transcript variants. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221513 | UTS2 (Myc-DDK-tagged)-Human urotensin 2 (UTS2), transcript variant 1 |
USD 420.00 |
|
RG221513 | UTS2 (GFP-tagged) - Human urotensin 2 (UTS2), transcript variant 1 |
USD 460.00 |
|
RC221513L3 | Lenti-ORF clone of UTS2 (Myc-DDK-tagged)-Human urotensin 2 (UTS2), transcript variant 1 |
USD 620.00 |
|
RC221513L4 | Lenti-ORF clone of UTS2 (mGFP-tagged)-Human urotensin 2 (UTS2), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review