CHP2 (NM_022097) Human Untagged Clone

CAT#: SC304990

CHP2 (untagged)-Human calcineurin B homologous protein 2 (CHP2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHP2
• Synonyms: calcineurin B homologous protein 2; hepatocellular carcinoma antigen gene 520
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_022097, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGTCGCGCAGCTCCCACGCCGCGGTCATTCCCGACGGGGACAGTATTCGGCGAGAGACCGGCTTCT
  CCCAAGCCAGCCTGCTCCGCCTGCACCACCGGTTCCGGGCACTGGACAGGAATAAGAAGGGCTACCTGAG
  CCGCATGGATCTCCAGCAGATAGGGGCGCTCGCCGTGAACCCCCTGGGAGACCGAATTATAGAAAGCTTC
  TTCCCCGATGGGAGCCAGCGAGTGGATTTCCCAGGCTTTGTCAGGGTCTTGGCTCATTTTCGCCCTGTAG
  AAGATGAGGACACAGAAACCCAAGACCCCAAGAAACCTGAACCTCTCAACAGCAGAAGGAACAAACTTCA
  CTATGCATTTCAGCTCTATGACCTGGATCGCGATGGGAAGATCTCCAGGCATGAGATGCTGCAGGTTCTC
  CGTCTGATGGTTGGGGTACAGGTGACAGAAGAGCAGCTGGAGAACATCGCTGACCGCACGGTGCAGGAGG
  CTGATGAAGATGGGGATGGGGCTGTGTCCTTCGTGGAGTTCACCAAGTCCTTAGAGAAGATGGACGTTGA
  GCAAAAAATGAGCATCCGGATCCTGAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_022097
• ORF Size: 591 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_022097.3, NP_071380.1
• RefSeq Size: 2389
• RefSeq ORF: 591
• Locus ID: 63928
• Protein Pathways: Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Axon guidance, B cell receptor signaling pathway, Calcium signaling pathway, Long-term potentiation, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Oocyte meiosis, T cell receptor signaling pathway, VEGF signaling pathway, Wnt signaling pathway
• Gene Summary: This gene product is a small calcium-binding protein that regulates cell pH by controlling plasma membrane-type Na+/H+ exchange activity. This protein shares sequence similarity with calcineurin B and can bind to and stimulate the protein phosphatase activity of calcineurin A (CnA) and functions in the calcineurin/NFAT (nuclear factor of activated T cells) signaling pathway. Another member of the CHP subfamily, Calcineurin B homologous protein 1, is located on Chromosome 15 and is an inhibitor of calcineurin activity and has a genetic phenotype associated with Parkinson's Disease (OMIM:606988). This gene was initially identified as a tumor-associated antigen and was previously referred to as Hepatocellular carcinoma-associated antigen 520. [provided by RefSeq, Jul 2013]