Livin (BIRC7) (NM_022161) Human Untagged Clone

CAT#: SC305009

BIRC7 (untagged)-Human baculoviral IAP repeat containing 7 (BIRC7), transcript variant 2


  "NM_022161" in other vectors (6)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "BIRC7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BIRC7
Synonyms KIAP; LIVIN; ML-IAP; MLIAP; RNF50
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_022161, the custom clone sequence may differ by one or more nucleotides


ATGGGACCTAAAGACAGTGCCAAGTGCCTGCACCGTGGACCACAGCCGAGCCACTGGGCAGCCGGTGATG
GTCCCACGCAGGAGCGCTGTGGACCCCGCTCTCTGGGCAGCCCTGTCCTAGGCCTGGACACCTGCAGAGC
CTGGGACCACGTGGATGGGCAGATCCTGGGCCAGCTGCGGCCCCTGACAGAGGAGGAAGAGGAGGAGGGC
GCCGGGGCCACCTTGTCCAGGGGGCCTGCCTTCCCCGGCATGGGCTCTGAGGAGTTGCGTCTGGCCTCCT
TCTATGACTGGCCGCTGACTGCTGAGGTGCCACCCGAGCTGCTGGCTGCTGCCGGCTTCTTCCACACAGG
CCATCAGGACAAGGTGAGGTGCTTCTTCTGCTATGGGGGCCTGCAGAGCTGGAAGCGCGGGGACGACCCC
TGGACGGAGCATGCCAAGTGGTTCCCCAGCTGTCAGTTCCTGCTCCGGTCAAAAGGAAGAGACTTTGTCC
ACAGTGTGCAGGAGACTCACTCCCAGCTGCTGGGCTCCTGGGACCCGTGGGAAGAACCGGAAGACGCAGC
CCCTGTGGCCCCCTCCGTCCCTGCCTCTGGGTACCCTGAGCTGCCCACACCCAGGAGAGAGGTCCAGTCT
GAAAGTGCCCAGGAGCCAGGAGCCAGGGATGTGGAGGCGCAGCTGCGGCGGCTGCAGGAGGAGAGGACGT
GCAAGGTGTGCCTGGACCGCGCCGTGTCCATCGTCTTTGTGCCGTGCGGCCACCTGGTCTGTGCTGAGTG
TGCCCCCGGCCTGCAGCTGTGCCCCATCTGCAGAGCCCCCGTCCGCAGCCGCGTGCGCACCTTCCTGTCC
TAG


Restriction Sites Please inquire     
ACCN NM_022161
ORF Size 843 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Reference Data
RefSeq NM_022161.2, NP_071444.1
RefSeq Size 1268
RefSeq ORF 843
Locus ID 79444
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the inhibitor of apoptosis protein (IAP) family, and contains a single copy of a baculovirus IAP repeat (BIR) as well as a RING-type zinc finger domain. The BIR domain is essential for inhibitory activity and interacts with caspases, while the RING finger domain sometimes enhances antiapoptotic activity but does not inhibit apoptosis alone. Elevated levels of the encoded protein may be associated with cancer progression and play a role in chemotherapy sensitivity. Alternative splicing results in multiple transcript variants [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) uses an alternate in-frame splice site, compared to variant 1. The encoded isoform (beta) is shorter, compared to isoform alpha. Isoform beta protects cells from etoposide-induced apoptosis.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.