EDDM3B (NM_022360) Human Untagged Clone

CAT#: SC305017

EDDM3B (untagged)-Human epididymal protein 3B (EDDM3B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EDDM3B
• Synonyms: EP3B; FAM12B; HE3-BETA; HE3B; RAM2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_022360, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCATCGTCTCTAAAGATCTGGGGCACACTCTTGGCCCTACTTTGCATCCTATGCACACTGCTTGTAC
  AGAGCAAAGAAGTTTCTTGGAGAGAATTCATGAAACAGCACTACTTAAGTCCAAGTCGAGAATTCAGAGA
  GTACAAATGTGATGTCCTCATGAGAGAAAATGAAGCTCTGAAAGACAAGAGCTCTCACATGTTTATCTAT
  ATCTCATGGTACAAAATCGAGCATATATGCACTAGTGACAACTGGATGGATCGCTTCCGAAATGCATATG
  TATGGGTCCAGAATCCTCTCAAAGTACTCAAGTGTCACCAGGAGAATTCCAAAAATAGCTACACAGAGAG
  CAGGAGCTTCAACTACATTGAATTCCATTGTAGCATGGACGGGTATGTTGATAGCATAGAAGACCTAAAG
  ATGGTAGAACCTATCGGCAACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_022360
• ORF Size: 444 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_022360.4, NP_071755.1
• RefSeq Size: 897
• RefSeq ORF: 444
• Locus ID: 64184
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: Testicular sperm are morphologically differentiated but are not progressively motile nor able to fertilize an egg. Post-testicular maturation requires exposure of spermatozoa to the microenvironment of the epididymal lumen. Spermatozoa undergo extensive changes in the epididymis, including enzymatic modifications, loss of pre-existing components and addition of new glycoproteins from epididymal secretions. These modifying proteins and enzymes are synthesized by epithelial cells lining the epididymal duct and secreted apically into the lumen, where they come into contact with, and may be absorbed onto, the sperm membranes. The proteins encoded by the genes in this cluster are synthesized and secreted by epididymal epithelial cells. [provided by RefSeq, Jul 2008]